Tetraodon_nigroviridis Locus dkc1
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis dkc1
Tetraodon_nigroviridis
dkc1
Un
SNORD83
3839..3916
7294
AAATGTCAGGCAAAGACTATTTTCGGTCTACTCCTGTTGCAAAGTTCTCGCGTTTGTTA
GCATGGCCGTAGGTCTAGCCGTAGCTCTTAAGCTAACAAATAAAAGCGAAAATTACTTGA
CACCTTTTAACCAATATTATATTTTATGACATTCCACACATTCAAATTACACTTAGCTAC
AAAATCTAAAAACGCTATCTCGTAATATTTTAAGAAAGGTGCTTACTTACTTGACCACTC
CGCTATCGAGTGGCGTCATGTCGAATTTGACGCTTTCCCTTAACCCACCAGCGGGGCGCT
GTTGTATATTTTTGGGTTCGTCTGTTTCCTGGTTCACGGAGAAATGTATAATATGCAACG
GTGTTTCAGAAAGCGTTAACTGAAACAGAACAAAAACATTATAATAGACGGCAAAAAGTA
TGTGTCCAAATATGTGGCACGCTTGCATACAAGATGATACGGTTTGTCACGTTGTTAATT
CTAGAAGAAAAGATGCAATGGTCTCAAACATGAAGGTTTGAATCAGAGAGAGAGAGAGAG
AGAGAGAGACATACATACAAAATAATGAATAAAAGGCAAAGTAAAGAATAAAGTAGATGA
TGGCTGCGCCAAAGAGTGGAATGATTTGGAGAAGTGGCCGGCACCTCTGATCAGCACTGA
TAAATGAGGTCATCTTCCAACTCTCAGCAAGTTGGAAGATGTTTTCAGCCCTCATTTTTT
ATCATATAGATTCACAATACTGTGAATTTTGATAACCGAGAACAAAAACTGTATTTATTG
CTTAGCTGAATATTGTACGAATATAAAACTTTATGTTTATAAAGTATGAACAAATTATAT
TGTAATAAAAACAGATAAACAACGAAATCCATAGTGTATTTTCAGTTGTTTAAATCTTGA
AGACAAAAATGTGTCCGTGTGTGCGTTTGCGTGGGGGGCGGAAGGAGAGAAGAAAAAGCG
GAAGAGGAAGAGGAGGGCTTTGAGAAAAATCTTAGTTCGACATGGCGGAGATAGAGGGTG
AGTCCCATGCTCATGCGGTTGAAAACTAACTTTTACCTATCTTGTAATTTTATTTTGCTT
ACAGCAAGTAAAAAAAGGAGCAACCAATACATTAATGAAGACAATAACAAAAACCCTGCA
TATTCAACATACAATTAAAAGGGCTTAAACGATTTCACTATCCTTGGATTTTTTTTTTCA
GAACCTAATGCCGTTGTATTAAAAACTAATTTTTCATCAGAAATGTGTAACTCTTGGTTT
AAATTATTTCAACGAGTCGCCGAACTAACAGATGTTAACGTTCACGACGCCAAATCGAGC
TCCTCTTCTCTGCCATTTGTTATGACGTCTAAACCTTTTAATGAAAAACAAATAACAACA
AACTTATAGAAACACGCGTAACAATTTAATTTAAGAGACACATTGTGGGATTCTGTTACC
GTACATAGAGTGAGCAGACCGCCCGGTTAGCTGCGTTAGCCGCGTTAGCCGCGTTAGCGC
GGAGCTCCAAAGCACGTGCTGATGCAGAGGACACGTGGCTACTGGTTGGCCTCGGTCTTA
GCCAGGGATCTTACCGAATATTTCAGAAAGGCTAAAACAATGCTCCGATTTTCGCTTTGT
CGAATTATCTACCTTTTTTCGTTGTGATATGCGTAAGAATCACATTTATATATATTTCCA
TTTGTGTGATTTTTTTTTCAGCCACGTCTATAAAGAAGAAGAAGATAAAGAAAACCACTG
AAGATGTTGGGGTGGGTTTGATGTTTGTGATCTTTAACAATGACTCCTGTAGTCTTTAAT
AAAACCTATTGTTTTTATGTTCATTTATTTGGTTTAGGAAATCCAGCAGAGCGGTGACTT
TTTCATCAAACCAGAGTCTAAGGTTCCCTCGCTAGACACGTCTCACTGGCCCCTCTTATT
GAAGGTAGCTAGCACGATTTCTTTAAAATAAAAAAGTGACATGGTGATATCTATGCTACA
AACGTGAATATGCTTTTTTTTTTTTTCCAAAGCAGTCTTCAGCATGTGAAATGATGAATC
TGTTTATCCATTCTCAGAGCAGCTGTCTCTTAGGTCTCTGCCTCTTCTCCCGTTCTGGGG
GAAGGGTCTCTTCTTTTGTGGCGTGGTTGTCGCAGTGTTTTGCTGGACGATGGCCCAAAA
CTTAAGAGAGATTAGGCCTGAGCACTGCCAAGATGAACTTTGCTCTGATCACTTGATGCT
GAGATGACAACTAGATAATAAATGTATCTTAACTTGTTTGTTACTGTTAGCTTGATTTCC
TCAAGCTGCTAAATGTGCCTGTTTTGATACTTAAAGTAGAATCTTACACTTGTTTTTGTG
CAGAATTTTGACAAATTAAATATCAGGACGGCTCATTACACTCCTCTACCCAATGGCAGT
AACCCTCTTAAAAGAAACATCCATGATTACGTGAGGTGGGTCACAGATAAGTCATGACCT
TACATGCCAACAGTGTTATGTGAGATACCATATTTATATGTGATAGAGAGTGAACACACT
CTCGCTCGGGTACGTTGCAGACTATTGAATTCCTGGCTTAATAATTAAGTTATATTCAAG
GTAAAGGTTTCTGAACCTTCTAGTAGTGCATATTATCAGTGTACAAAAGACACTGAAGAA
GTTAATACTTTTTATCATCTGTACTCGCTGCTAATTTGGAATGCATACACATTTCTAGTC
TTAACTGTCAGTGGATGTGCCTGTAGTTGCTCTGAATCCTCACTGCAACTGTCACATTCT
TTGATAAAGACTTTAAGGAACTTATCAGTGACACATCACATGAGGTTGCAGCACTATCAT
GTAAAGGATGACGTGCACCTCATTGGGAATTGTACACAAAATATTAGTAACTATTGATCA
AATGTGGTTGGATATTTTTTGAGTCTGTTATGTATCACTGTTGTTTCATCTTACAGGCAC
TGGAAATGTTGACAGGCGCTCTATTTCAGCGACCGCCTCTGATTGCTGCTGTGAAACGTC
AGCTGAGAGTCCGAACAATTTATGAGAGCAAGCTGATCGAGTATGACCCGGAGAGACGAT
TTGGTGGGAGAATAATTTCACCGGTTACTCTTTGATGAAGGTGAATTAGACTCTAATCAC
GTCTTTGTGTTTCAGGGATATTCTGGGTGAGCTGTGAGGCAGGGACTTATATTCGGACTC
TCTGCGTCCACCTGGGTCTCTTGCTCGGGGTTGGAGGGCAGATGCAGGAATTAAGGAGGG
TTCGGTCTGGAGTGCTTGGAGAAAAGGTATTCATCACTACTTTTTTTTAAAATATGGTTC
AAAGTGTTGAGTTCTGCCCTGCTGCTCAGTGCAGGTCTGATAATTAAGCTTTGAAACAGG
AAGCTGCAGTGGAGGCCCATTGTTGCAAGATCTGCAAACCCTGAAGCCTCGGTGCTGCTA
ACATAGTATCTTGTCATCACTGCTGATGTCTGTCTGCTCTACTAGGACAACATGGTGACT
ATGCACGATGTCCTTGATGCTCAGTGGCAGTTTGACCACAACAAAGATGAGTCATATCTG
CGGAGAGTCATTTTTCCCTTGGAGAAGCTGCTGGTGTCTCATAAACGCCTCGTGATGAAG
GACAGTGCCGTGAGTCTTTTTGTCACCTTGGTAACCCCAGCAAACAGGAGAACTTGCCAT
TGATTCAATGTCTTTTCCAGGTGAATGCCATCTGTTATGGAGCAAAGATTATGTTGCCTG
GTGTCCTCAGGTATGAAGATGGCATTGAGCTGAACCAGGATATTGTTGTCATAACAACCA
AAGGCGAGGCCATCTGCACAGGTAAGGCCCCAAAGATGAGGTAGCAATTTCAAGGTGAAG
CCATGTGATGACTTGATTCATGTCAGTAGCTGTCTGGGCTGTGATGACCTCTGATCTATC
ACCCTTTTCTGATGGCTTCCCTCATGTTTAGTTTTTAAGTGACAGAACCTATTTACGTGA
CCATTAAAATCCAATAAGTGGCTAGAGTCAGGTATTCATTTTGTTAAAGTCGACCGTTTA
CATAATTCAGAAAGGCGCTAATCGAAAATCCCCAGTGTAGGTTTCAGTTCACTGGTTGGG
TTTCTGTCGATATGCATTTATATTTGCAGGGTTCAAAAAGGCAGAAGTGTCTCATTCAAC
TTTCTTCTGCTGCGTGTCTTGTTCTCTTGACACGATCACTTGAATAATTTTAGAAATCAG
ATGATGATGATCAGACTTATTTGGGTCGTGTAGACGAGGGGAGCGGCTGACTCGCATTCA
CTCTTCCTGCTCTTTCAGCTGTGGCTCTGATGACGACAGCCGTGATCTCCACATGTGATC
ATGGTGTCGTGGCAAAGATCAAGAGGGTGATTATGGAAAGAGACACTTATCCCAGAAAGT
GGGGTTTGGGACCAAAGGTAAACTTGAATTTATACCCTTTGAACTACCTGATGGGCTTTT
CTCAGTTAGTCACACGGTAACAATTAAACATTTCCAATTAAACACATTTTGTGACAAAGG
TGTTAACAATGTGAATTATTCCAAATTTGTAAGTAAAGGCTGCACTAAATCGAGAAGTCT
AAAAACGTACATTTCATTAGCTCCTTACAGATTTGTTCCAAAGAACAGCACATGGTGAAT
GTAAAGATGTAACTGATCTTTTAAAATCCTGAAGCCCTACCTTTCTACAGTGCTCTACGG
ATTAAGGCTACTTTGCAGTATTGATAATTTATGCATGAAATCGCTGAATATTGATTTTGT
TGTTTGTTTAGGCTAGTCAAAAGAAAATGATGATTCAGAAAGGACTTCTTGATAAACATG
GAAAAGCAAACAGCAGCACGCCGGCTGACTGGAAGGATGAATACGTGGACTACAGGTGCG
TGGTGCTGTTCAGACAGGTACTCGATCACATGCAGACAGTTATCCCTCATCTAGCTGTGG
TGCTCTCTGAGGGAGTCGCTCTGCTACAGGAATGTTCAGCTCTGAGCTTCATCACTCTGC
TGTTGGCTGAGCTGCAGCTCAGCTGAGAACACACACCATGTGGAAGTCACTTTTTAACAC
CTTGAGTGGGAGAAAGGGCTGCTTAGACCATTCGCATTGTTTGCTTATGTTGGGAAAAGG
TTTGCTGTTGCTGTACTGTCTACTTCATTTTTGCTAGTTGTGTAGCAGCGCCCCCCCAAC
CTTTTTATTGCGTCACAGACCGGTTTAATGTTGGACTGCATTTTCAAAGACTGGCCATTA
TGTGGCTGATGAATACAACAAAAGAACACGGCGTCATGAAAACTGGGATTTTCTAAAAAT
GATAAACTGTCAGAATCCAGGTGTGTACCCAAATGCAGCACACCTGGGTAATAAAACTCG
GCTGAATCAGCAGCGTCGGGGCAGGGCACACAGTCTCTTACTGGGAAGCAGGCGTTGAGA
CGTAATCCAGAACAGGGTCGGAAGCGGGCGGACTGGAAATCATCACTGGAAAGTTGCAGA
ACAAGGCCACAATCTGGCACTGAACCAGTCAAAGTCCGAACTTGTATATGGTGCTGAATG
GCTAAGGAGCTGACTGTTTCATGATAAGAAACGTGTCAGTAATGAGCCGTTAAAGGTTGT
AACAAGGAGAATCTAGTAATGTTGCAAAATAAAACAACGGTTGGGGGACCCTGCTACATA
TATATCATATTTCTACTCATCAAATGCATTTTATTTAAATTATTTTAACAGCGTCAAAGT
GAACGAAGAGCAACAGAACACAACCACAAAGGTAAACTGACCTCATAAATTCAGTATTTG
ACCCTTCAAGTGGAGAACTTGGATGATTGTAGAGATTCTGTCTGGTTGGCTGTGATAAAA
GAAGGCTGTGTGAGACTGACATCAGCTTGATTATGTGCAGAGAAAGAGGGAGGTGAGTGA
CACTGATGGGGAATCTTCAATAGCAAACACACCATCTGTAGATGAAGTGAAAAAAGAGAA
GAAGAAGAAGAAAAAGGTCAAACATCAGGAAGAAAATTCTGGGGGATTGGAGCAGGAGAC
GGAAATGGAGGTGTGAAATTCAAATTGAATTCCTTGATTATTTTTCACTAAATTTTCATG
TTAACTGTGTTCATAGAGATTAATATTCAAGTCCACCCCTCCTACCTTGCTGATGGCAGA
TTTAAATAGTGTTGAAGGATAGCTCTGCTGTAATTCAGACATTTTCCATGTGCTCTTGCC
TGTTCAAACCATTTTCTGGCTGATAAAATGAACCTTCTTAAATGTGTTATAGGCTGGTGA
AAGTACAAAAAAGAAGAAAAAGAAGAAACAAAAAGATGCTGACACTCTGGAGTAACAAGT
GCTGATAACTGGGAACTGTCGCTCTGGCCACAGCCTCACCTATTGGAACAAAACACCTCC
TTGGAATGGAATAATAGACTGCAGCAAACACAGTTCTTTGTATTTTTTTTATATATATAT
ATGTCAAAAATCCTTTTTTTTTTTTCTTTCTTTCTTTCAAAGTTGTAAATAGTCGACCTA
AAAACTTTTTGGAAGTTTGAAATAAATGTTTTCTGTATTTGTTGGCACTACTATCCTTTG
AACTGGGCTGGAACAGCAGAATTGTTTAATTCTGAAGGATTTACTTGAAGAAACCGCTGA
CCAAGAAACATTGCTCAAAATCTAAAATAATGCCAATGGCATTTGTCTTTGTGGAAGGGT
GTATTGTCAAATTAACTCACTCTAGGGTAAACTGTAATATGGAGCTTTTAGGGGGAAAAT
AAGGACTGAATGAGCAAAGCTGAGATAGGGTTAGTCTCCATTCTTTAATCCTTTGAACAA
GTGACAGGATAAGTGTTTGGTTTAAAGATGCACCAGGAACACACCTACCGTATTCTGAAT
TCTAAACTCGGCTGGAAAATGTAAAAGCCTTGCGCGCACACACGGTTTTGGGCTGACTCC
CCTGGTGCAGAAACGATTTAGGATTTGAAATGTGACGTCATATGCTGCCTGTTTCTGAAT
TGGCCAGACACGGTGGCGCGTCAGTACGCGTCAGCTAGAGACACTTTGACAATTCTGGTC
AGGATTCTCCTATTTTAGTTTTGGGGAATGTATCTGGTGCATAAAACGCATCCAGAATCT
CAGGTGTGTGGATGCTGCAGCCACAGATGCGCCACATAAAATAAAATATTTGTTTGTCTG
TTTTTCAGACTTTGGTGTCCAGAACCCTGCCATTCATTTGGTGATCATTTAGTGTGAAAG
ATCAGTAAAATTGTGTGAGGGCTGTCATTTATTACTATCGACAGACAGTGTTGAGAGCAC
CGTCGACGTCATTACAATGTCCGTAAAAGTCGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1016, 1701..1750, 1837..1923, 2343..2434, 2603..2819, 2903..3062, 3135..3265, 3465..3608, 3680..3800, 4278..4396, 4751..4854, 5276..5299, 5688..5730, 5860..6009, 6232..6294
1001..1016, 1701..1750, 1837..1923, 2343..2434, 2603..2819, 2903..3062, 3135..3265, 3465..3608, 3680..3800, 4278..4396, 4751..4854, 5276..5299, 5688..5730, 5860..6009, 6232..6294
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved