Tetraodon_nigroviridis Locus Mono:SNORA69
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORA69
Tetraodon_nigroviridis
Mono:SNORA69
Un
SNORA69, SNORA36
1001..1095, 3296..3389
2095
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGA
GCTCTAATGAAGATATTACACTTCATACCAGTACTATTAATACCAAGCTTTAGAGTATAC
ATCTTATTTTTCCAGCGATTGTAATTTAGACTATAGCGAACTGCACTGCAGCGCTAGTTG
TTCATAGAAAGGTTAGTGTTGCATTCATCACTAGGTCAACTTTAATGCGCACTTGCTCCA
GTTCCAGTGTGTTTAGGTGCTTGTTTGGTCCAGATGTGTGTAAAGCAGGTCTGCAATTGC
AGCAGTTCTTGTGGTGGAGTGCTGTCATTAACCCTGCTGAGAGCATCTTCATCCTCCTGC
CGGAGAGCTCACACTCCTCTTCACTGTCACTGGGCTGAGGAAGCTCCAAAGCTGAACATT
GTTGTTGGTCCAGGCTTAGGTGTTTAGTCAGAAAAAGACTGGTCTGGAACCATTCTGGGT
CAACCATGGGATCGGCTTCACGTTTCTTTAGGTTTCGACTGAGTCTGTGAATGACATTTT
AAGTCCTGTTGTCTCTTTTCCTGCTCCAGGTACAACTCCAAGAGGAGACACTGGAGGAGG
ACCAAGCTTGGCCTGTAAGCACACAGGCGCGTGGCCCCCCACGTCCCCCCACGTCAGCAT
CTGTCGGGACCTTCAGCTGCTGGGACTGAGCGTGTGTGATCTGAAGCAGCAGTTTTGTAC
AGACGTTGGTTATGCTCATGTTTGACATTAAAAGATCCGTGATCAAACTTGAAAACGAAG
CTGTGGCTTTATTCCCCGTTTCTGTCTCCGAGCAGGTCGTGTGTTTCTCTAAAGCAAAAC
CAAATGTTTAACTGGGTTAGAAATGTTGCTACAGAAGGGAAAAACCTTTGAATCTGACCA
CAAGAGTCAAAGAAAACATCATCTTTAGGACACACAACACAAGAAATGGAGTTAAAGTTG
TCCGGTCGGGAAAGGAAAACGCGTTAAATGTGCACCGAATGCTAACAAATGTGGACTAGT
TGTTTTAGGACAGTGAGAATTCTGGCTGATAATCAGTATAAACATGAGTTTATACCCCTG
CGGATTTGTGGAGGGATGATTATCTTGTTTAGTTAAACAGTTATCTGTTCTTGTTACCCA
GAAAGGAGAGCGAGGGCAGCATCCTCCTCAGTGACCCCATCATCCAGGCCCCCGCACTGT
CCGCCCCGTCAGCGGGGGTCACCCCGCTGGTCCCCGCCTGCTCCGGCTCGTCCTGCACGG
TGGAACCAGAACCAGAACCAGAACCAGAACCAGAACCATCGCTGCTGCTGCTGTTGTTGT
TCGCATTCTGCGCGCACGTCCAGCGGTGCTCGTCGTCCCACATGCCCAGCAGCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved