Tetraodon_nigroviridis Locus Poly:SNORD2
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD2
Tetraodon_nigroviridis
Poly:SNORD2
Un
SNORD2, SNORD2
1668..1742, 2001..2074
3074
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGTATTTATACGGTTGTGGATGT
ATTCTAACTGTTTACAAGCATGAGGCCGGTCAAATGAGGCGATAGTTTAGGCCAAATTGG
GCATCGAGTTTCACGTTGAAACGAGTCCGGCTGCATAAAGGCAATAGGCTTCACCGTCAA
CGATCTTTCCAGTCGCATGCTCAGGTCGGGAACGGATCATGTCTAGCGATTCTGCTGATT
ACAACAGGTAAAAATACCACAAAAATCCTTATTTTGACACATCTACCACCGTTTCGTGTT
TGTAAAAGCGTCACCGTAGTTTGGGGCGCTCGCCTGGGCCAAATTTGTAAAGGAACTCGC
CCTGCTAAGTAGGCCGCAACCATTATCCTGGTCTAAACCGTTAGCTCTAACTGACACGGT
GTCATCGCGCTTTTACGTTACCGTAAAAGGCCACTTACGTTTAAAACCACCTTATTTATA
CACGTCGAGACGTCCACCCCAACGGCACGGTTGTTTTCGTGTGAATCGAGCGGGTTTTGG
GTGGTTTCCACCGGTGCCGGCGTGCCTTAGCTAGCTCGGCTCTATTATAAGGCAGTGGTG
GCACAGGCCTGATTGTCCGACATATTGGCTAATAGGAGGAAGCTGAACTCCATGTTGAGA
ACGCGCCGCCGAACGTGTTCGCGGGCCTCAAACCACCCCATTCCCGGGTTCATTTCAATC
ACCACGGCTGCGGGTCGAGGGGCGACGGTTTCGGGCTGGTATAATCGGGGTTTGGGGGCG
AACGGGGTAGTTTGTCCCCGCTCGCGGTGTCTGACACGTGCGCTCGGCGCCCGTAATGGG
CTCCTCTGGGCGGACACCGGAGCTCCGAGGAGCCCCCGGCGGCGCCCTGACGTCAGATCG
CCGCCGGCTAACCGCAGATCTGCTCTCTCCCGCAGCTCAAAAGACCATGGGGGGCCAGAT
GGAATGGAGCCTGATGGTATCATCGAGGTACGAGCTTGGAGTAATCCATCCGACGCGAAT
TCGTGGGTTTGACTTTACGTGTCTAATCTTTTTTTTTTTTTTGGTTCGTTATTTCAGAGC
AATTGGACCGAAATTACAGACAATTTTGATGACATGAACCTGAAGGAGAGTCTTCTCAGG
GGAATATATGCGTATGGTTTTGAAAAGCCCTCTGCCATTCAGCAAAGGGCCATTATTCCT
TGCATTAAAGGTATGGAAACTTCTTCCTGCGATTACTAAATTATCTCTGAGTGATGTGAT
GCTTAACCATCTTTCGGGACTTACCCATTAATGGGGATACTTTTTTATTTTCACTGATCA
CTCTATCCGGTTTTTAGAATCGCATGTTGTGTAAAATTAAGATTTATTTTAAAACTGTCC
CAATTTCCCACTAGGTTATGATGTCATTGCCCAGGCCCAATCAGGTACTGGCAAGACGGC
CACGTTTGCCATCTCCATCCTGCAGCAGCTGGAGATTGATCAGAAGGAGACCCAGGCCCT
GGTGTTGGCTCCCACCAGAGAATTGGCCCAGCAGGTAACCCCCCACATCTCCTCTCTAGA
CGTTTAAACTCGCCGTGGGCGCAGCGATATGATGGCATACCATCTTTCGGGACTGACTTT
TACAGTGGAGATGTTTTACCCTTAACTGATCGCTCAACTGCTGCGTTCAGCCTCCTGTCA
GTCGATTCACCGGCGTCGTCCTCAGTCTCTCACCTTCGTCTCCACAGATCCAGAAGGTCA
TCCTCGCTCTAGGCGACTACATGGGGGCAGCGTGCCATGCCTGCATCGGCGGGACCAATC
TTCGTAATGAAATACAGAAACTCCAGGCTGAGCTCCGCACATAGTGGTGGGCACACCAGG
ACGTGTGTTCGACATGCTCACCAGGGGGCATCTGTGTGAGTACCGAGTTGATGGGTGTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved