Tetraodon_nigroviridis Locus rpl23
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl23
Tetraodon_nigroviridis
rpl23
Un
SNORA21, SNORA21
2472..2608, 3336..3472
4734
TTATCATCATCATCATCATCATCATCGTCATCTCATGAAATGGACCTAAAATTCAAATC
TATCAGACATTAAAAGACTCGGGAGCAAGCCCGGCTGAAAGAGTTGGGTTTCTATTTATG
TGTTTATTTATTTTAGAATGACTAAATAGCATCAAAGTGATGGTGACTGAAGCCTGTTTT
GTTTGTGAAGAAAAAACTCTTCCCAACATCTGGACAGGTTTAAACGGCGATAGGAGTAGG
AATCTGGAACGATCTGAAACGCCTGAAAGGACTGTGAAGGAAGGAAAGACAAACTTGGTT
GGCTGGGAGAAGACAGGAACGATAGGGAAAGAAGAGCTTGTGATCAGCCATCACATCATG
TCTCAACCATGATGGAGGCAGCGTTATGACATGAAACCTGCTAATTAAAGCAGAATCACC
GCTGATTCCTGCTGACAGAAGTAGAATCTTAATTCAAAACCTGATCGAAACTCTCTTCTG
AAACTGTGATGTTGAGGTAAGATTTGAAAGAGAAAAAAAAACTTTTGATGCTTCTGGATC
AATGAATACAAAGATTTTGTATTTGTATTCATTTCATTTGTATTTTTGTATGTGTCGGTT
TTACAGGCGATAGTGTAAAATAAAAAGACTGTTCAGAAAGAAATAATGGAGGGATGAATG
AATGTCTTTTTCCCCACACGTAAAAGGCTTCTTGTACTACTTCTTGTACTAGAACGTACA
GGATGAAAGCTCTATGGCTGCATTGAAGAACTTTTTTCTGAGTAACCTCTGACATTCTGA
TGAAGTAAACCGACGCACAAAGCGACCGTGTGCAAGTTAGTTGCGTTGGTCCTCAAAGAG
ACGAGAGACAGAAGCTGTGGCGGTGATCTTCTGCCCCCTAGTGGATCTCCGAAATACTCT
GCCTACATGCGATCGTTGCGGGCTAAAAAAAAATGTTTTTGCTTTGGAGTGGTTGCGAAA
AAAAAAAAAAACTCGTTTCTAGGTAAAATGTTGTCTTATCTGCATTAGGAAAAAATAAGG
TACAGACTGAGTATGAGAAGGTACGACTCGATTTAAATTAAAAGACAGAAACCTCCTGGG
TTCCACTGCGACTGATTTTGCCGACTGTTCATGAACGCTTCAGCCCCGCCGTGACCCGGA
TGTAGTTCTGTTTAACTTTATATCCCATAATTCCTTTCTCCGCCTTCCTCTTTCCCTACT
GCAGCAATGTCTAAGAGAGGTATGAGGCTCGCCCCACAAAATCCACATTCATCCTATGTG
TTTTACTCCAAACGAGATTATATCGCGTTATGTGGTTGTATATATCATGGAAGCAAAGAC
GTTTATGAGGACAGTTTTAACATTAGACAAAAAGTTTGGGGATAAAAGAGCATTTTTGTT
TCTTCGCTGGCGGAAGCCATGTTTAGCTGTCAGCGCCATGTAGCAGAGAAACGAGAAAAG
TCACGCATTGAAAATGTGTTTGTTAGAGGCTCGTTTTAAATACAACCGTTTCATTTAACA
GTACATGGCTTTTGGGTGTCATTTTTTAAAATGTTTTAATTCTGGAGACGGTATAAAAGG
TAGTAAAGGCTATAGCTAGCAATAGCTGGCAACGCTAACTGCTATCTCTTGCATATCCTG
TATAATGCTTGGATTGTTTAGTTTGAGATATATCAACGCAAAATAAGCACCCAAGGCCGC
CCTGGGATTAAAATGTTATCATTGCAATACAAGTGTTTGTCTTCCTTTGAAAACAGCTAA
CAGAAAAAGCATCTGTACAACAGTTCAGATATCTGTTCTGTTCATTGATGATACTGAAGT
TTGTATTGGTCTTCTTACATGATGAGAGGTAAAATCAACAGTTTTAATTTAATGATAGTT
CTCTCAAGTTTTCTAAATCAACTTGAGTCGTGTCAGTATCTGCAAAGCTGAGTGTAATTG
TCTTTATGTTGATAGAGGCCATTTATGATGAGATGTAAGTTTGAGTCTGTGTCCCACGGT
GCTGGTGATGTTGGTAACAGACAGATTTGACTGTTTTTGCCCTCTTTCAGGACGTGGTGG
TTCATCTGGAGCCAAGTTCCGCATCTCACTGGGTCTCCCAGTGGGAGCCGTCATCAACTG
TGCTGACAACACAGGTACAGCAGTCGTCAAGTGCTCATTTGGTAGTCCTTGTTTTGATTT
AAAGCCCTTGTGATAATTGGACAACTTTTTCAACATTTCAAGGTGCCAAGAACCTGTACA
TCATCTCTGTGAAGGGCATCAAGGGCCGTCTGAACCGGCTGCCTTCTGCAGGAGTGGGTG
ACATGGTGATGGCCACAGTCAAGAAAGGCAAGCCAGAGCTCAGGAAGAAGGGTGAGTGAA
CCCCTCCGTCCCTCACTAACTCTTCCTCAGGGATTATACTGTCCCGTGGCTCGTATTCAG
TTCACAAATAATCATTTGAGGCATTGTTGTGACAAAGCAGCGTGACTCTCGTGTACTGTG
GGAAGACAACCCCCCCTTCCAAAAGCACTTGCTCGGTCCCCTCAGTGGCTGGGTGAGTTG
TCGACGAAGGGCACATTGACGTCGTCACTGTGGGTGAGACGGCAGCGCCTGGCTGTGGCT
GACTGGTCTCAATCAGTGGGGAGACAAGCTGCTGGCTGCCACCACGCTGCAGCCTCGCGA
AGGGGAACTTTAGGAGGAGGAGTTGGTAGCCTAAAGGCTCTGAGTGGGGTCCCGTGGCTC
CCAGGTGAACCTTGAAACTTTCTGGTGTTTTATGTGTTTGTTGTGAAAATGGCGTCTTTC
TTCAGCTGAGGGTTGATGTGATGCGACTGCCTGCTTGTCCAGCAGGTCTGAAGGAAACTA
GCTGGATAAGTTGTAGGTTAAAAAAGATCTGCTTGACCTGATGAAACTAGTCTGGTTTAC
ATCTGTCCTTTAAAAAAGCCCTGGTCCTCAGGGTTACACACTTGCAGTCATGTGACGTGA
CTGGCTTGTTCTTCAGGGTCAGTTCTAAGATGATCCCATCCTCTGTCCACAGTGCATCCT
GCGGTGGTGATACGACAACGGAAGTCGTATCGGCGAAAAGACGGCGTGTTTCTGTACTTT
GAAGACAATGCAGGCGTCATAGTGAACAACAAAGGAGAAATGAAAGGTAAGTGTGTTTGC
TCACGCCGATCATCGAATGGGTATTCAAGCAGTATGTAGGCAGAAAGGATTTAGTCACGG
CAGGAATTCAAAAACCCAGCTAATTTAGCATTTAAGTGATGATGCAGGTTCTGGCACATC
CAGCCTGTAATCACCCATCATGGTGGCCAAATGTCCCAACAGCCTGGTTAGTTCTCTCAG
TCGTTTGTCTCCCAGCCTGGGTAAAAAGAGGAACCCCCCCTTCCAAAAGCACTTGCTCGG
TCCCCTCAGTGGCTGGGTGAGTTGTCGACGAAGGGCACATTGACGTCGTCACTGTGGGTG
AGACGGCAGCGCCTGGCTGTGGCTGACTGGTCTCAATCAGTGGGGAGACAAGCTGCCGCT
AGACGCTAACGCGTCCGCCGCATCGACCCGTGTGTCCTGAGTGAAACGCACCGTCCCGTC
ACGAGTTGGGTTGTTTTGCCCCTGAAGCTGCTGTGGTGGTGAACTCTGCCCGCCTCTTCC
TCAGGGTCAGCCATCACCGGCCCCGTGGCCAAAGAGTGCGCCGACCTCTGGCCCAGGATC
GCCTCCAACGCCGGCAGCATAGCCTGAGCCGGACCCCGCACCTCGTTGTTTTCAATAAAA
AGTCTCGGTAAATCAGTCCGACGTCCGTGTTTTATTTGCACTTTATTTGCACAAAAACGT
CTGGTTCAATTTAAGAGCTCGTTCTTCATCCTGATGCTTTTCAGTTTGGATTTGTCAAAA
CGTAAGATTTCAGAATATCTGAAGTTCCTTAGAGCTGGAGTTCTATTGAAGGTTCTAAGG
GGACACAATGGAATCTAAGATGTCGCAGTAACAAACCTGGTAGCTACCAGCGTTCATCAA
CCATGGATTTCACACACGTTGGTCCACGAGTGTTGGCCAGCACCCTGTTCCGTTTCCTGA
GTCGCCACTAGGGGGCGTGACAGGCTCCAGAGGTACAAAGACTGACAGAAGTCACACTGG
TGGGTAAAACATTCAAAACAAGGATTTGGGGATAATGTTGGAAACCTGAGTTCAATTAAA
ATGGTCCCGGTTTACAGTTGGAGAATGTCAAATGTAAGAAAATAGTTACTGAGCTCACAA
TGTCCTAATAAATGGTGTATTTCACCTGGTCAGGGGAAGATGGCCCCAGCGCACACCTGG
GTACAGACCTGGTCACCTGACTGGCTGCTCACATGACCTTTTGTTGGGACTGAGTTTATC
TCAAACCTCCTCAAATCTATTTGCTGCTAAAAATACAGTGAGGATTGTAGAGCATCATAG
CAAAAAGGTTTTGGTTTCATGCTGGAGACACACCAGATTCCATTTAAACTGTTTTTTAGC
CCAGGGAATATTGGAGCTGTGGTAGGGAAGGATCTTGGTCTCCATCTCTAAGGTTAGCCT
CCGTCTGTGCTATAAATCCGGATGGTGCAGAGCTAAGTGACCTTTTATTAGACGCTCTGC
CTTATTCGTCTATCTTTGTCAGTTTGTGGAGGGATGGATGAGACTGGAAGCTCGGCTGGG
ACTCCTGCCTCCAAGACCGTTGGTCCATCACTCACGGTATCGCGTCCAGCCTGGGAACAA
AGGGCCTCTTCCTGCTGGGCTTGATCTCCGTCTCCGCGGGGGGCTCCGTGCTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1218, 2030..2113, 2193..2330, 2992..3105, 3604..3734
1206..1218, 2030..2113, 2193..2330, 2992..3105, 3604..3686
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved