Tetraodon_nigroviridis Locus Mono:U3
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:U3
Tetraodon_nigroviridis
Mono:U3
Um
U3
1001..1153
2153
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGGAGAGGCTGAGAAAGATGAAAGCAGAGCCAGACGTTACTTCCAGGAT
CTTTTCTTCAGCTGGTGACTGAGAAATGTGCTTCTGAAGAGTTTGGTCTCACTCCCACGA
AGATGTTTCTCCTCCACTGATGAAGACTCTCCAGAGTTTCTCTGAGACTGGTGAAGGAGA
CATGAGCAGAGTGGGCTGTTTGTTGAAGTGACCAACGGAATCCTTTGATGTTTCCTCTCA
GCTGATCTCAGGTCTCCACTGGAGAGTTCTGACAGAAACAACAAGGACGTTCAGAGTTAG
CTTTTAGCAGCGCTGCTCTGACTGATGCTTGGTGACTTCCATCTAGACTGATCAAAGGTC
TGATCTGCTCCACCTGGACGACCACCAGCAGCTGAAGCTCCGCCCACTCCGGTCTGGAGC
GCTGCCAGGAGCAGGTCTGACATCAGGCTGCTCTTCCTGGACGTCACTGCTGCTGGTTTC
TAACATCTTCTAGTTTGGGTTTATTTCTTGTGTCGTCTTTGCTTTGATGATTGTTCCACT
TTTTTCTCCACAACTTAGTAACGGTGCTTGTTGCTGCTGGTCTCCAGGAAGGGTTTGCAT
GTGCAGACGTGTTTATCAGGCTGGAATCAAACATCCTTGGACATTGATCCCTCCCTGCTG
GCTTTTATAGCAGCAATTAAACTGGTGATGAACTGGAGGAGGAAACCTGAAAGAGAAAGT
GTCCAGATCAGATTCAGCAGGAAGACGGAGGACAGACACAAGGTGAGTGGACACGAAGGA
TTTGAGAGAAGAATCATCGTCAATCAGTCTGGTGGTAAAAACATTCAAAGACAATGTTGT
TGTGTCATAAATCTGACAGAAAAACGTTGATTTTTATCTGTTTCAGCAGTATGGAGGAAG
AGGAGGACAGAGCAGAGTCTTCGGTGTCCAGCTGTGTGTCTCTGAAGAGTGACCAGTCCA
AAGGTCGACCTGTAGACTTCAGAGGTGAAGCTGGACCTTCAAACCCAGGGTAAGAACGCG
GAGTCACTTTATGTTATATGAGGACGGTTGGTCACGTGACCAGCAGCAGGCTACATGTTT
CCACCTGGAGATGTTTGAATCAACTCTAAAACTCCAGGAGGTCTTACCAGCTGATGTCCA
GAGGGATCAGCTGCTTTGATAGTTTTCAGATCAGCTTTGAAACAATTCACAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved