Tetraodon_nigroviridis Locus Mono:SCARNA8
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SCARNA8
Tetraodon_nigroviridis
Mono:SCARNA8
Un
SCARNA8
1001..1131
2131
cgctcggctggaggaggagcttcagcggagaaggtccagcaggtgaggcgttccggctc
tgcccgaacctgcgctgggttcctgacgcgctcgtccggcaggttcgctccctgtggtcc
tccctggaccacatgatctgcagcaccagagcggacagagaggctgtggacggcgtcctg
cggggccaggcggaccagtacgtcctggacgggacgggccgggtcctggaggtgccgcgg
acctgccgggagcacctggagcagcggcctcaggtgagctccggtgaggcccggacctcc
tgcggccgggacctgagcgtctctgtcctccagctgagctcgggccgcctgtatacctgc
ggaccagctgcgcctgctgctgctgctggagctgatgaaccacagcctgcagctgctgcg
ggaggagcgccgccgcctgcgccgcgccgccgacctgagcccagcacgcctgcaggacca
gcgcggacagatgtcacgggcgcttcagagcctgcagctcatccggtagctccgcctccg
ccgcgcgctgcggccggccgacccgggagctgatccctgcgcgtctcctccagccagaag
atctccagggaggccgttcccgaggccaggagccgcatccgggagctggaggccagctgg
gacaggaggtggtcggagggccggcaggagtccccactggccgccttcctccaggaggag
cacgccggcgccgcgctcctctcgcccatggcgccgctctccttcgcaccgctagcccac
gctagcctcagcctcttctcccagtttcctgctgtgcttccaggtgagctccagacagcc
tcgggctgcggttagccgccgttcctgagcgcagcctttcttctttcagaggagagacgg
gtggaggcggggccaccggaggcggggccactgaaagcagagccaccggaggcagagctg
aggtgctgcagtagcaggtacggtgaacccgtgtgtgtgtgtgggaggcagatacctggg
caggcctgagcgccggcctgtccgccacgcgtcctcccgacagcatcgctgctctctgat
gaccgcggcgagttgagggaaatcgccgcggacagatacggagcagacaggcgccgctag
ccccaggctaagcgtctgttgtgcgctaacctctgtgtccctgaagcagcccagaagccg
ccgtggtccccgtggaaacggccaacacgtccctggactggctgttggacctgtctccgc
tgctcagggcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved