Tetraodon_nigroviridis Locus rps4x
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rps4x
Tetraodon_nigroviridis
rps4x
Un
SNORD61
3339..3411
4773
AAAACTCTTGCTCTGTAATGATTAGTACAGTAATGTTACAAAGGCAATTTCGAACAATA
TAGTTTCTTTTACGCTAATAAAATAAAATAAAATAAATAGGATGTTGTACTGATTTCATC
TAGACTGGTTCGGAGAGAGGAATGTCCCCGTGATATTCTTTGCTGTTCTTTCACCAGATG
CCAACACAAATGGGTCAGGAAATTAAATCTGCAGGTTTGTTGCTTTTATGAGAACAAACT
TCTAGTTCTTGCTCCTTCACTAAAGCATTTGAAACGCCACAGACTTGTGATTCCAGGGAA
GTAAACGGCTCCAGGTGCATCCCGGGGCTGATATGAAAGCCCCAGGGGGTGCAGGAGCTG
GCCCCAGAGAAAAGGAGGCCAGTTGGTATCACTTTTCGGAGGAAGACTGAGGCCTGCGAA
GAGTCTAACCTCCAGATGTGTAAACACAGTCTGAGTTCTGAGATACACTGGTGTTTCCTG
AAGGACAGACTGACACATTGACTAAAATAAATAATTACGTTTAATGAGTGGAGAATAATT
TGATATTGAGTGGAAACTATATAGAAATAAATGGGAGGAATAAGACTACTCGATGATAAC
TTTCTTTTTCCTTGGAAATAATGAAATGTGGTCTACATTTCACAGAAACCAGTGGTAATT
CAAACATGTAGAATTATGTTTCATGATTACTACAATTACTATTTGTTCATCTCTAAAACA
TAACGTATAACTACATAAGTATGTAAATATATGAAACAATCTAAATAATAAAAGTCTATA
AGGCAAAAACACCGGTTTTAAAGCTAATAATTGAGGACATTTACACACCTTTGGCATTCA
TACATTCCTATTTTGCCCACTATAAATAAATAAATAAATAAAAAACATCAACATTGAGCT
GTCGCTGTGCCTGAGCAGGGGGAATAAAAAGTGCGCTTTTCAGATGTCCCTCCCCGCACG
CCGTAGCCATCCTTATCACTCTATACCGGAAGCCAGGAGGTCCTTTTCCCCGCAGACTCC
ATCATGGTGAGCTTGTTTCCCTCACGGCTCCTTTCTGAAATAATCACTAAACATCACTTT
TACTCGTGGATAAATCAAACACTTGCATAACCTGATGCGTAATTCTACATCTAATAAAAC
GTTTTATTCATATATTGAAAATAAACGCAGCGATACTTTCTGTTTTTGGACGATCTGATT
TGAGTGTACCCTGCTTCGAAAGCTATCACTCGCCGCTTGTTAGCCTGACTTTTTAATACC
GCTAGTGTGCTGATTACAGTTAAAAGTCGAGTTTTTGTTTGTGACCCAATCTTTACGATC
TTAATGAGCACCATGTTAGGAGTACATTTGTGACAGTTTGGCGATGCCAGTTATGCTCAT
TTTTTCCCCTAACCAGCTAGCATAGCATGCTAGGTTGTGTAGCCTAGCATGCTAATTCAT
TGGAGAGAATATGGTCCGTGAGAATCTCAGCTGTGCGTAGTTCGCTTCTTTGTATTGGAC
TGGTGCTTGTCTCAGAAGGTGACCGAGTTTGATCTCTCCTATCCAGGCAAGAGGACCGAA
GAAGCACCTGAAGCGCGTCGCAGCGCCGAAGCACTGGATGCTGGACAAGCTCACCGGGGT
CTTCGTGAGTAGCACGTTGAACGTTTCCTCTGCTCAGATCAGCATCAGCAGCCATCAGGG
CTTCCACAGAGGTGCTGTCGTTACGCTTGTGGAACTGTGTATTACTTAGGATCTGGTACG
TTTTTACCTTGCACAATAGGGTTCAGGTCATTTAAAATACAAAGCTGTTTTATTACCTCG
CTTAGGTGATTTGGCTTCTTTAAGCAGCTGCTGTTATGCCAGCAACACTTTTCCCCCCCA
GTATTTATATTATCATCTGCACTGTCCAGTGCCTAACTCAGGGGGTTGAAGACTTTATGG
TATTTAGCTCTGAATCTTAGCCAGTGACCCCGCCTCTGGTTCCTAGGCTCCCCGTCCTTC
CACCGGTCCCCACAAGTTGAGGGAGTGCCTGCCCCTCATCATTTTCCTGAGGAACCGCCT
CAAGTACGCCCTGACTGGGGATGAGGTGAAGAAGATCTGCATGCAGAGGTTCATCAAGAT
TGACGGCAAGGTCCGCACCGACATCACCTACCCCACTGGATTCATGGGTGAGTGGGCTCC
TGCGGACTACCGATCGTGTGGAACGGCCACCGTGGATGTGTGTGTTCAATCGCTGGAGAA
CAGATGTGCAGCAAAACCCATTTGGTTATTTTACAAATTGGGTGTTGATCATGCCACGAT
TACTGCCGTGCTGCGGACTCTGTGGACTAGTGCACGGTTCTGTGTGTTAATAAGTGCAGT
CTTTACCTGCTGACACCCTCTGGTCCTGGAGTCAGTCGTGCTGTTGCACCCTGCAGTCAT
GGAGCATTACATGACTGCATACAGTGCGTTATATCTGCTGTCTGCATGTTCTTTCTGAAT
TCCAAATGAATTCCCTGTACGTTCTGGCACTGTGTGTGAAGCAGGTTGCTCTTCCTGGCT
CGGTCTTGTTTTAGTTGTATTTCCTGCTTCAGGCGTGTTTGCTGGTCCGTTACAAAAGCT
AGAATTTTATAAATTAACTGGTTTTAAATAAATGCAGACTCAGATAACCTGGATGGGTTA
GAGTCGTATCATTTATACTGCTATAAATGCTGAGTGCTTCCTGTTCCCACAGATGTGATC
AGCATCGATAAGACCGGCGAGCACTTCCGTCTGATCTACGATGTGAAGGGACGCTTCACC
GTGCACCGCATCACAGCTGAGGAGGCCAAGGTCAGGCCGCTGGTGCAACTGTTGCCGCCG
AGCCGCTTCAGAAGCTCGTCCAGTCTGGAGGTTGGTCGGCGTGGAAGTGATTTGGAGCTT
CTGTGCTCGTCTGTCTGCAGTACAAGCTGTGCAAGGTGAAGAAGATCATCATTGGCACCA
AAGGCATCCCCCACCTGGTCACCCACGACGCCCGCACCATCCGCTACCCAGACCCGCTCA
TCAAGGTCAACGACACCGTCCGCATTGACCTGGAATCGGGCAAGATCACCGACTTCATCA
AGTTTGACACGGGTGGGTTGCTGGCCACGGTGCCCCACAGCGGCGCGTCCTCTGTGTGCT
GACGGGTGCTGTTCCCTCAGGTAACATGTGCATGGTGACCCGGAGGTGCCAACTTGGGCC
GTATCGGCGTGATCACCAACAGGGAGCGTCACCCCGGCTCCTTTGATGTGGTGCACGTCA
AGGACACCACGGGCAACAGCTTTGCCACCAGGCTGTCCAACATCTTTGTGATCGGCAAGG
TGAGCAGGTCCCGAAGCAGGCTTGGGGGACGTCCGAGGAGCAATGATGACCTTCAGCTTT
TGAGCAAGGGATGAAAATAACCTCAGCAATTCCTCTAAGAAGTTCTGAGCTCCAAACCGG
CAAATTAGGGATTCAGGGATGGATATTCCGCAGCATCCTAAGCGGGTCCACCCTCACCTG
GAGGCTTTTCCCTTAGAATGACGTGTGCTACCTCGCTACATTCTCAAGTTCAGCTGCGTT
GACTAGCGCTTATAGGTGATGCGGCGTGACTCTGGCTCTGATTTTATTCTTTTATTTATC
TCGTCCCATTTCCAGGGCAACAAGCCGTGGGTGTCCCTGCCCAGAGGAAAGGGAATCCGC
CTGACCATCGCCGAAGAGAGGGACAAGAGGCTGGCTGCCAAACAGGCCAGCAGCTAGACC
GCTCGGCTGTGGAGGCCGACGCCTGCTGTTCAAATAAACTGTTATTTACCCAAAGCCGCC
GTCTCTGTCGTCAGTCAGCTCCTCTTTTGTCGGCCACTCTTGCTTTTTTAATGGCGGACG
TGTGAGTTCAGGTGAAAGCAGAGCAGATTAGCCCCGCCACCACTTCCTCCCAGCTGTTTA
TGCTGGTAATCCTTCCTTGCTGGCCTGAGAACCAGTTTGAAGGCTCCATGTTTCCCCACT
TCCTCCTTCCTTTCATCTCGGCTGCTCCCCCCTCCCTCCCCTCTGTCCACCCGCTCATCC
TCCCGTCCCAGCCCTGACTCCAGTCCTGGTCCATATGGCAGCCTGCTGCGACGCAGCCTG
CTCAGCTCTGCAGAAACCTGGACCGGTGCTCGCCGCCGCAGCGTGTGTGTTGATGTTCTG
GACGTCCCGGTGTGTGTGTGAGAGGCAGCCACGATCGCCTCACTGACCTCAGAAGGACTA
CTCCACCACAAAACCAGCCATCTTTCACCACTTGTGATCCGCCGTTTATTGAAGAATTAA
TTTATTTGCTTGACCTTTGACCTCTGTCCCTGCGTCAACGCAGCCCACGTCTAATGCGTC
ATAAAGGAAAACTCCGTCATTTCTCCATGCGAGCTTCGGTCCTCTGCAGAGTAGAGGATG
AGTGGCGGCAGACGTGGACGCAGCGTTCCTCCCCTGCGCGCGCGCAGGAGTGCAACAGCC
GTCGCGTCTGATTTGCAGAACCGCACACGGAGCTTCGGAGTTGATTTGGGTGCTGGGAGA
TTGTAAACAAACGGCAAAATGTAAGTCAGACACGTGCCCGGGGGGCTGTTGTTTGTTTCC
ATGGCAACGTGAGGAGCAGCTGAGCTGTGCTGCCACTCTTGGGTTGCACCGGTGGGGCGG
AGCGAGAGCGACGTGCAGTCCTGCTGACGTGTGCTGGAACAGCCCGTCCTGAAACAATGA
AGTCATTTTGGGGGGGGCGGGGGGGCGGGGGGGCAGGACAGCTGTTTCGCATCAACTGAC
CGACTGTGGCGGAATAAACCCGCCGCCAGCTGCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1546..1623, 1966..2146, 2692..2789, 2900..3071, 3140..3298, 3615..3773
1023..1025, 1546..1623, 1966..2146, 2692..2789, 2900..3071, 3140..3298, 3615..3716
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved