Tetraodon_nigroviridis Locus haus6
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis haus6
Tetraodon_nigroviridis
haus6
Un
SCARNA8
3156..3286
4888
ATTAAAAAAAAAAACGTTAATTCATCAGGGTTCGGGTGCGGGGAGGGTGACGTCATCGT
CTGACCCGGAAGCAGTTTTCATGAACCCGATCTTAAAATTGGCGCCATCCGGTTTAGTCC
TGTTTGTGTTCCTTGGGAGGGTTTCACTCGGCACCGTGAGCTCGGCCGTCAGGTAACCAC
ATTTCGGGCTGAAATCCTGCCGTGCTGGCTCTCTTCTTCCCCGGCGAGTCTTCGGATGTG
CGAGGACAGAGAAGCGGCGCGTCCTCCGGCTCCAGCTAGCTCCGGTTCTCCAGATCGCTC
CGGTTCTCCAGCTCGCTCCGGTTCTCCAGCTCGCTCCGGCTCCAGCTAGCTCCGGTTCTC
CAGCTAGCTCCGGTTCTCCAGATCGCTCCGGTTCTCCAGCTAGCTCCGGTTCTCCAGCTA
GCTCCGGCTCCCCAGCTCGCTCCGGTTCTCCAGCTAGCTCCGGTTCTCCAGCTCGCTCCG
GTTCTCCAGCTAGCTCCGGTTCTCCAGATCGCTCCGGCTCCAGCTAGCTCCGGTTCTCCA
GCTCGCTCCGGCTCCAGCTCGCTCCGGTTCTCCAGCTAGCTCCGGTTCTCCAGCTAGCTC
CGGCTCCAGCTCGCTCCGGTTCTCCAGCTAGCTCCGGTTCTCCAGCTCGCTCCGGTTCTC
CGGCTAGCTCCGGTTCTCCGGCTAGCTCCGGTTCTCCAGCTAGCTCCGGTTCTCCAGCTA
GCTCCGGTTCTCCGGCTCGCTCCGGTTCTCCAGCTAGCTCCGGTTCTCCAGCTAGCTCCG
GTTCTCCAGCTCGCTCCGGTTCTCCGGCTAGCTCCGGTTCTCCGGCTAGTTCCGGTTCTC
CAGCTAGCTCCGGTTCTCCAGCTAGCTCCGGTTCTCCGGCTCGCTCCGGTTCTCCGGCTA
GCTCCGGTTCTCCAGCTAGCCGCCGAAGCTAACGGGCCGGAGGGTCCACCGCGAAGCTTC
GCCTCCCGGTTGCTCCTTGTTCACTCCCAAACATGGCGAGGCCGGCTTCGACGCAGAAAA
GGAACGGCAAACACCTGTGGTTTGCCCTCCTCGGGCTGGGATTTCAGCCGGACTCGGAGC
TTGCTTCCTTCGGGAAAATCAACGCGAACGCCAGACGCACCAGCCTGGGAGCGTGAGTCC
GCCTCCGGCCGCGTTCCGACCGCAGCCTCGCGGCCCTGACCCAGGTTTGTGCCTCTGGCC
AACAGGACCATGTTCGACAAGCCCAACAAAGACGCCTTCCACATCGTTACCCACTTCCTG
TTGGACAAATTAAACCCGACGCGCTTCCGCGAATCCTACAGGTAAGCCGGGAGCCCGGCG
GGGTCTCCGAGGCCCCGGGGCTCCAGGACAGGTGTCAGCGAGTGTTCGTGACCCGCCCAG
GTTCTGCTGGCCGGTTCTGAACCACAAAGCTGATGCAGAATTCCGCAAAGTCACGTGTTC
CTGGCTGCGGGAAATCATGGTAGGAACCAGGAAAGGCCGGATTCTCCCGCCCCAGGGCCG
TTGTCCAGCCATGAACGGGCTTGTCGTTGCTTCCTGTGTCCAGGATGAAAGCGCGGGATC
AAAGGTGGCTGCGTCTCTGCTCCTGTCGCCCGGAGGACCCAAGTTCACCAGCCTGATGCT
GAACCTGGCCCACCACGTCATGCTGCAGGAGATGAAGACCTTCCGCACAGGTGCGCTGCG
GCCGGCTGGTCCCGGGCCCCGGCTGGTCCAGGGCCCCGGCTGGTCCCGGGCCCTGGCTGA
CGCTGTCTGTTTCAGAGGACAGCTGGGTTCCCGAGGCGGCGGCCATCCCCGCCTCCTCGC
TGGACATGGCGGCCAAGCGTCTGGAGCTGCTCACCCGGAGGTTTCTGAGAACGGCCGTGG
AGCAGGACCGCTTCCTCCACGAGTACCAGAGGAGAGCCCAGTGAGTCCCGGCGGGTCGCC
ACGGGAACGCCGGCTGGGGCGCTGCGGCGCTGCTCTGGACGGCGGTCCCGGGTCACCCGG
CTCTCTTTCTCCTCCAGGCTGCTGGTCCGATCGGTGAAGGAGCTGCGGGCAGAAGCCAGC
CGGTACCAGGAGCTCCTGGCGTACGTGAGAACCGTGGCTCCTCTCGCGGCTCCTGCGCAG
GAACCGGTCTGATTCCAGCTGTTTGCAGGCATCAGGGGGACGGTCGCTCGGCTGGAGGAG
GAGCTTCAGCGGAGAAGGTCCAGCAGGTGAGGCGTTCCGGCTCTGCCTGAACCTGCGCTG
GGTTCCTGACGCGCTCGTCCGGCAGGTTCGCTCCCTGTGGTCCTCCCTGGACCACATGAT
CTGCAGCACCAGAGCGGAGCAGGAGGCTGTGGACGGCGTCCTGCGGGGCCAGGCGGACCA
GTACGTCCTGGACGGGGCGGGCCGGGTCCTGGAGGTGCCGCGGAGCCTGCGGGAGCACCT
GGAGCAGCGGCCTCAGGTGAGCTCCGGTGAGGCCCGGACCTCCTGCGGCCGGGACCTGAG
CGTCTCTGTCCTCCAGCTGAGCTCGGGCCGCCTGTACGCCTGCGGCCAGCTGCGCCTGCT
GCTGCTGCTGGAGCTGATGAACCACAGCCTGCAGCTGCTGCGGGAGGAGCGCCGCCGCCT
GCGCCGCGCCGCCGACCTGAGCCCAGCACGGCTGCAGGACCAGCGCGGACAGATGTCACG
GGCGCTTCAGAGCCTGCAGCTCATCCGGTAGCTCCGCCTCCGCCGCGCGGCTGCGGCCGG
CCGACCCAGGAGCTGATCCCTGCGCGTCTCCTCCAGCCAGAAGATCTCCAGGGAGGCCGT
TCCCGAGGCCAGGAGCCGCATCCGGGAGCTGGAGGCCGGCTGGGACAGGAGGTGGTCGGA
GGGCCGGCAGGAGTCCCCACTGGCCGCCTTCCTCCAGGAGGAGCACACCGGCGCCGCGCT
CCTCTCGCCCATGGCGCCGCTCTCCTTCGCACCGCTAGCCCACGCTAGCCTCAGCCTCTT
CTCCCAGTTTCCTGCTGTGCTTCCAGGTGAGCTCCAGACAGCCTCGGGCTGCGGTTAGCC
GCCGTTCCTGAGCGCAGCCTTTCTTCTTTCAGAGGAGAGACGGGTGGAGGCGGGGCCACC
GGAGGCGGGGCCACTGAAAGCAGAGCCACCGGAGGCAGAGCTGAGGTGCTGCAGTAGCAG
GTACGGTGAACCCGTGTGTGTGTGTGTGTGTGTGTGTGGGAGGCAGATACCTGGGCAGGC
CTGAGCGCCGGCCTGTCCGCCACGCGTCCTCCCGACAGCATCGCTGCTCTCTGATGACCG
CGGCGAGTTGAGGGAAATCGCCGCGGACAGATACGGAGCAGACAGGCGCCGCTAGCCCCA
GGCTAAGCGTCTGTTGTGCGCTAACCTCTGTGTCCCTGAAGCAGCCCAGAAGCCGCCGTG
GTCCCCGTGGAAACGGCCAACACGTCCCTGGACTGGCTGTTGGACCTGTCTCCGCTGCTC
AGGGCGCCCGTGGCTCAGGTGGGTGGTCACCTGTGGCGCCGGTCCTGGGCCGCTCAAGGT
TCCATCCGGTTTGGCTTTCAGGTCAGCGCGAGGAGAGCCGGGGACCCCAGGTCCCAGACC
CGGACCCTGGAGCTGGAGTGTGACAACCTGGCGGATCAGGTGAGGCCTGCAGGCGGTCAT
GTGACCCAGGAGCGGGCTGCGCGGCTCCTCACGCTCCTGTCAGTTTGCAGACGCGGTGGC
GACTCCTGCTGCCGGCCTCAGCGGGGTGGACCTGGAGGCCCTGCTGGGCTCGCTCCACGC
TGACCCCTTCTCCACCAGGAAGCAGCTGCCGCGCACGCCCGAGAGCCTGAGTGGGTCGGC
GCCGCCCTGCGCCCGCGCCGCCCGCCGCCGCTGCGCTAACCACCTGTTTCCAGTCCTAGA
CGTGAAGAGCTCCTGGCGAAAGGCTGTGGAGGAGGACCGAGCCCAGAGGCTGGGCCGCGC
CCAGGAGACGCCGGCGGGCGATGGGAGGAGCACCAGCGGCCCCTGGGCCACGCCCACGCC
GCCTCCTCCTTGGGACGCCCTGGCGGCCGGCGGCCTCGTTCAGTTGGGCCTGGACCAGGA
GACGCTGCCGGAGCTGCCCGGCTGCGACAGCCTGCTGAGCCTGGACGAGGACGAGGGCCC
CTCCCCGGACGCCAGGGCCACGCCCCCTCGGGGGGGCTCCGCGGGGCGCCCGGACCGGGG
AACCGCCGAGAAGGTGTTCTCCCTGGACCTGGACCACCTGGAGGCGCCGTCCACGCCCAA
GACGCAGGAGTACAGCCTCCCCAGCCTGATCGCCTTCTCCCCCGTCGACGACGCGACCTG
TTGAGCGTTACCGTGGAGACGTGGTCCGGAACTGGTTAAACGGTCACTGGTTTTAACCCT
GAACCAGGAACTGTCTGAATAAATGTCTACGTAACCATGGCAACGCAACCGCTTACTGTT
GATTTGCACCGCCGAGTGTTTCCGAGACGCCGACTGTAGACGTGAACGTGTGACGGTTTG
GAGGCGGAGGAAATAAAGGTGTCCGAGCTCGCGGCTGCCAGTCTGGAGCTCCACAGGCGT
CCGGACGCTCACGTGGTTCCCGGGAGCAGCTCGGCTCACCTGGCCGTGTGACGCACCTGT
TGCTCGGCCGGTTGGCGACTGCAACGTCCCTTTACGGCCGGAAGGGGGCGGCAGAGGGTC
GAGTGGTGATGAAGTCACCGAACAAGACGCAGGGCAGGCCGGAACTCGACGTCCTCCTTC
AAATTAAAACAAGATTGGCAGCGACCGCCCTCGCTGAGCGGGTTCAGTCCTGTTCTGTCT
GAACGAGAGTAAACTGAATTTAATTAATTTCACCAACAGTTCGGTGGTCACGCAACAGTC
AACCCGCAACCATGAGACCGACTTTCCTCTGCGTTTCTCGGCAGGCGAGGAGCTGATGAA
AGGCAACGGGGGACCTTTGTTCTGAAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1131, 1205..1300, 1380..1458, 1543..1669, 1755..1899, 1997..2059, 2128..2185, 2245..2415, 2476..2666, 2736..2965, 3032..3119, 3341..3437, 3501..3578, 3643..3769, 3833..3888
1001..1131, 1205..1300, 1380..1458, 1543..1669, 1755..1899, 1997..2059, 2128..2185, 2245..2415, 2476..2666, 2736..2965, 3032..3119, 3341..3437, 3501..3578, 3643..3769, 3833..3888
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved