Tetraodon_nigroviridis Locus rpl18a
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl18a
Tetraodon_nigroviridis
rpl18a
Un
SNORA68
1534..1663
3530
CATTAACACTTCATTTAGAGTAATTATTTATTCTCTCTGCCCTCCACACATCACGAATC
TAGTGAGAAATGAGCAGAATTAGAAGTTTAGCTTAGTTAGAACAGCTAAGCTCAGCTAAG
TCAGAGGAGCGGCGGCGTAGTCCACGCGCTGAACATCCGGGTCACACACACCGGAAGAGA
CCCGTTGACTTTTCACAATTTAAGCCTGAACGAATAGAACTTGTTTATCCCGCGAGGGGG
AAATTGCACTGTTCCCCTAGCAGCAATACAACAATAAATATGGGGGCAAACTCACAGAAA
CAAGGACATACAAAATTACAAACTCTTTATACATATAAAATAGAAAATAACATATATACA
GGTCCTAAAGAAGAACCGTCGTTGGTGGAGGTTGTCTGGAAACAGTAGAAGATCCTGATA
AACTGGTCGTTTTCAGTTGTATTTCAGATGATTGAGATGTACCCTGATGTATATTTTAGG
GGAATAAATAAAAAAAACAAAGAGTACACTAGAATATATGTTTATTATCCTGCACTGGCG
ACATTGCAGTGTCCACGCAGCAGCGTACAGAGCAAAAAATAAAAGGAAATAAGATGTAAA
TGACATACGAGACAATTACAAAATAATAAATAAACTCTATAAAAAATTAGATCACTGTGT
TGATTTTATAAAGATTTTTGGACGTCGTTGAAGTGTTTTTCTTTACTATCTTGTATTAAA
ACTGCACAAACGCAAGATAGAGATTAGCAGAGGAAGTAGTCGCAGTAGAGATGCCTGACA
AATCCCGAAAACAATTATTCTTGTCAGTAAAGAAGAAGAGGATCGTTTGTCCCAACACTG
ACTGACGCCTCTTTACAGACCCAGAAAACGGCTTTACTGGGTTTGGTGTTTTATTTTGAA
AGCGTCTTCAGTTCGCTCGCGGAAGTTGTCTTTTGGCCACGCCTTCTCTTCCCTCTTCTG
ACGTCCGCGTGCTCCGCCCTCGCGCTTCCTCTTTTTTTTGTGGCAGTGAGACAGACACCA
TGAAGGCGTCCGGCACAGTACGTAAAACTCCTCTTTTATCCATAAATGCTTCCAAGGCGC
GGACCGTGAGCGCCGATATCACCCGATAAAACCCCGTTGTTCTAGGTTCCTGTATAACTG
TCTCAAAGAAAGCAAATTCAAGGGTTATTTCGAGTCTTGATCGTACCGTAGCGGTCTTGG
GAGACAAGATGGCGGCCGCAGGGCCATGTGGGCTGTTGGTCCGGACGATGTGTTAGAGCC
ACAGCGAGGCCCGAAAAAACAACACATCCAGTGAAAACTGGCCATCATTTTGTCAGAACA
TTTGCCTAATATCTTGTTCCCCGGTTGTAACCAGTCGGTTGTCTGCAGGTGGCCTCCGCC
GAGGTCTCGATGGCCAGCCTGGCTGTTGGGGCTCCGTTCACGCACACGCATCATCCGCAT
TTCGCGTCCTACACACCGACTTTGAGTTGTTCCTTTGCTGCTTTTGAGTGAAGTGCCCGT
CAGATGAGCGTACTCGCGGAAAGCTGCTCCCCAGCATGCACCCAAACCCAAAGCTCCCAC
CTGCGGTGGTGCGAGCTTGTCTGGTGTGCTGACAGAACCTGGGCCCCTGTCGCCTTTCTG
GGACTCTTCTGTGTCTCTGAAAGTGAATTCAGGGGTCAACAATGGGCCTCTCGGCCTGCC
GTGTGTGCTGATGGATGTTCCCTGCCCACAGCTTCGGGAGTATAAGGTCATTGGGCGCCT
GCTGCCCTCGGCCAAGAACCCCGCGCCTCCGCTCTACCGCATGAGGATCTTCGCCCCCAA
CCACATCGTGGCCAAGTCCCGCTTCTGGTACTTTGTTTCCCAGCTCAGGAAGATGAAGAA
GGCCTCGGGCGAGATCGTCTACTGTGGCCTGGTACGTAGCGCTGCAGCGCCGGGCTCTGC
GGGTGGAGGAGGAGCATCTCTGGCCGGGTCCTGGCCTGCGGTCCGCTGACGGAGGTGTGG
TCTGCTTCAGGTCCACGAGAAGACGCCCCTGAAGGTGAAGAACTTTGGTATCTGGCTGCG
CTACGACTCTCGCAGCGGAACTCACAACATGTACAGAGAGTACCGAGACCTGACCACGTC
TGGAGCCGTCACGCAGTGCTGTGAGTAGCCGCCGCGCCGCCGCTCACGCCGGCTCCCGCC
ACCAACCGCGGTCTCTCTCCGCCCTCAGACCGGGACATGGGCGCCCGCCACCGCGCTCGT
GCCCACTCCATCCAGATCATGAAGGTGCAGGTGATCGCTGCCAACAAGTGCCGCCGACCG
GCCATCAAGCAGTTCCACGTGAGCGCCCCGCCGGCCCGGCTCTGGAGCTGCGCCGCGCTC
CCCGTGCTCATGCAGGTTCTTCTCTGTGCAGGACTCAAAGATCAAGTTCCCCCTGCCCCA
CCGGGTCCTGCGGCGCCAGCACAAACCTCGCTTCACCACCAAGAGGCCCAACACCTTCTT
CTGAGATGGTTTCACGCTCGTTTCTGCGTTTGCCAGGAAATAAAACTACTCTGACAGAGG
CGTGCCCATGATTCTGGTCGTCTGATGGTGGGTTGCACACAGGTCAAAGGTCAGAACGAG
CACAGGGTTTACCTCCATGACCTCAGACACGCCCACACCTGACTCTAAAGCAGCTGCAGA
GCGTTGATGGGTAAAATGATTGATTACCTGATTCTGCCGCTGCGGTGACGTCATCAGGGG
CGGTCTCAGAAGAATCAGTCATCAGCACCAACACCTGCTCCTCTCCGGAAACTGACCTTC
ATGCGTTTTGGGGTGTTGAAGGTGTACAATTACCACTTTAAAGCAGGTAAACCGAGCTAG
GCCACGCCCCTGCCCTTCCTGGCCTGAGTATCGACCAATAAAGTGTGTTTACGGTCAATC
ACGGCCGGGCCTGGTTCACACACCTTTAATCAACCCGGGATGAGGCGAGACGCAGGAAAA
CTCACCTGAGGAGCAGAAAATGCAGGCCATCGGGAGACAAGTTCCGGCCGGACGCAGAGA
GACGCATGCGCGTCAGCCCGCCCATCACCGGAAGTTCACCTGAAACAGAAAGATGCCGCA
GGAATCGTTTTACAGTCTTTACACCTTTAAAACATTTCATTCTTGGCCAGTGATTAATTA
GCCTGCGGGCTGTGGATGTTTAAGGCTCCTCAACCTTCGTCCATTTAAATAACCAAATTT
AAGATCAAAGTAATCGAAAGTAACCTGAACAAAATCAAATGTGTTCACCGCAACGAAAAT
GCGAATAGTAGTAGTAACAATAATAGTAGTAATAACAATAATAATAGTAATAATAATGCT
AATAACGTCAGAAACCAGTCTGGTGTTAAATGCCGCGCCCTGGTGGTCACCGCTGGAACT
GCAGCATCTGCCAATAATGATTTTTCTTTTAAAAAATATTTGGGAGCCAAAAAAATAAAA
AACTACTCAAAGTTTCAGTGAATTTAGCTGCAAACATTAACACATTCATCGAGTTATTGT
TCAAAGTCTCTGGAGTGAATGGGTGAGTTTCTCGTGTTGGCCCAGCAGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1036, 1711..1890, 1990..2119, 2188..2297, 2371..2530
1013..1036, 1711..1890, 1990..2119, 2188..2297, 2371..2463
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved