Tetraodon_nigroviridis Locus ENSTNIG00000003986.1
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis ENSTNIG00000003986.1
Tetraodon_nigroviridis
ENSTNIG00000003986.1
Un
SCARNA24
3420..3552
6008
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCAA
GCTGATGTATAACCCTAACCCTAAAGCTTTCTGAGACCTGAGCACGTAAAACATTAGTCA
CATAATGTGACATTTTTCTTATATTTATTTAGAAGTACTTATAATTAAATTGTTGTCTCC
CTCCAGATGATGGCAGCACACCAGACAGAATAGCACAGATCATGGGACCTCCTAATCAGG
CTCAGCATGCAGCAGACATCATTACTGATTTGCTAAGAAGTGTTCAGGCTGGTGGACCTC
CAGGAGGTGGCAGGGGTCGTGGTCGTGGGCAGGGAAACTGGAACATGGGTCCACCTGGTG
GCCTACAGGAGTTTACCTTCACTGTTCCAACTGTGAAGACAGGCCTCATTATAGGAAAAG
GCATGTGGTTTAATAACAATACTGTTCTGTATTAATTGTCAAAACTATAGTGGAGGGGAA
AAAAAGCATCTAAACAGACTGCATATTGTTTTTGTTGGTCTTAACTCTAGGTGGTGAGAC
AATCAAGGGCATCAGTCAGCAGTCTGGAGCAAGGATTGAGTTACAGAGAAACCCTCCCCC
TAATTCTGATCCCAGTATCAAAATGTTCACAGTTCGTGGTTCGCCTCAGCAGATTGACTA
TGCCAGGCAGCTGGTAGAGGAGAAAATTGGGGTATAATAATTTTCTTTCAAAATACGTTC
CAAAGGTTCCAGTTACTTGACTAATTATTCTATCTGAATTTTTTTGGGGCGTGTGGGCGG
GTGTTTTTTTGTTTGTTGTTTTTTTTTGGGGGGTGGGGGGTTTGGTGTTTTTTTGTTTGT
TGTTTTTTTTTGGGGGGTGGGGGGTTTGTTTTTAAAAAGGGAAATGTATATAATTTGGGT
GGTAAAATTGGAAATAATGGAAAAATTGGGGGTAATGGAAAAATTGGAAAGAATGGTAAA
AAAGGTGAAAATTTGGGTAAATATAAAAAAGGAAAATAAATTAAGGGAAATAAAGGAAAT
AAGTAAGTGGGAATTTTATGTTTTATATTGTAAAAAAATTTTATAAATGAAAAATTTATG
TTGTGTGATTATTATTATTTTTGTTAGTGGAAAAAATGATAATTAAAAGAATAAGGGGTG
GGGAAATGGATAAAAAAAATGGAAAAAGGGACAGACCGATCCAAGTGGGTACCTGCTATT
AGTCAAACTTCAAAAGATCTCTAATATACTGGAGTAACATTGTAAAACTATATTTTTTCT
GTTTATTAAATAATAACTACTTATGACACCTGAATGTATTGATTATCAATACTTCTTTTA
TAGTTTTACTTTATTTACTAAAAACTGTTTACTCTAACCAGATAAAGCAGCAGCTGATGC
AAATGCTGCAGCATGGGCAGCCTATTATGCCCAGTATGGTCAGCAACCACAGGCTCCAAT
GACTCCAACAAGTGGAGCCCCTGGCACGACTCAAAGCAATGGCCAAGGTAACTAGATTGT
TTGTCAAATACATGTCTTTTTCGTTGACAGGAATTTGCTTGACCTTTAGCAATTACTTTT
TAAGACCAGCTTTTTTCAAAATGCTTCAGGGGCCAGGGTAGTTTTTTCCAAAAATCTAAA
ACTGACAGCTTGGACCCAGGCAGGTGCAGCGCAAACTAATAAGAATAATTGACTAATTAC
AAGTACCGTTTTTTTAACAGGTGATCCACAGGCTGCTGGTCAGAGTGGACAGGCAGATCT
ACTCCAAGGCCTGGGAGGAATATTACAAGAAAATGGGTATATGAACAGTAGTTTCAGTGC
AAACCTATTCAAAAAACAAGACCGTCTAAACAGCAACATTGGGCTAGGCTAATTGATTTT
TTCTTTTGGAATTTTTTTTTTAACCAGTCTGGGTATTTACTACTGGCCTGCTGTGTGGTG
TTTTACTGTTTAGACTGCAACTGTCTTTGCGGGACTCGGCTTTGGACGTAGCGCTGCCTT
TAAGCAACTATTCGCCGGCTTGTTGCTGCTATTGAATGAGCAGTGTTCCATTAATGTTGT
GCATTCAGGTTTGATCTAAATTACCAAGGAGGTATGTTAAACTATCATTTTTCTGCAGGA
CAACAGAATCAGCAACCTCAGGACTACACAAAGGCCTGGGAGGAGTATTACAAGAAGCAA
GGTTGGTATACTTAAAATCTAAATTGAAAGATCACTATTAAGTTCCAGCTTTTATTCCAC
AGACTTAGCTTTTAATAAGTTGCAACATTTCATCAACTAATACATTCCTATTCAGCAATG
GCTATTTGTACTTTGGCTGGAGCAGCGCAAGGCCAGATCTCTGACTTCCCAATTGCCATT
GACAAAAAGCAGAAAACTCCATAAGTTCAGCTTTAAGGTGAACACATGTTACCATCATTG
TTTAACAGACGCATTGGTGTTAAAATATACCAGTATGTCTAACGCTGATTTTTATTTTTA
GTTTGAAACAAATGAGTGAATGGTAAAATGACTAATTTTGCAATCTTTCAATCTCTGAAA
GACTGCACTTCACAAATTTGAAACCAGTTTTGGAGTGCTTCCTACCTATGGTTAGGTACA
ACATCAGTTAAAAGCTAGTAGTCTTGGAATTTTAAATGGATTAAACAGTTTCCTATAAAT
CAGAATATTCTTAGTTTGCTGGTTTTTGTTTTTTTTTTTTGCTTTTGTGGAGCTCCTCTG
CAAAAAAGTTAATGGAGCAAATGCTGTATCTGCATGCTTTGAAAGTAGTTGTGTTGAACT
GTGTTTTTTGTTTGTTTGTTTGTTTTGTATTTTTTTTTTCCTTTTCTTTTTTTTTATTGA
AGGGTGGCTATGCTCTTGTTGCAGCCTTTCATAGTAGAGCTGCTGCTTACTCAGTCACCC
AACAGAAAAATAGAAGGTTACTGACCTTACACCTGGACTTACCGGTGCTGGGTTCGTTCC
CCTTCTTATAATAAGTGTAAGCCAAATGATACTTGAACTGAAAAATTCACATTAGGAATC
AGTTTGCATTATTACAAACGCTGCAGGGATTTTAATTTTTAATAAAAATGTTGATATGCT
GGTGTTTAAATGCAAACAAACTTTATCTTCCACTACTTATCCAGAGAAGCAGTGGCTATA
GTCCGAGCTCCTCTCAGGATGATTCAGCTTTTCACCCTATCTCTCTAAGGGAAAGCCCAG
CTTCCCTAATGAGGAAAACAGTTTCAGCCGCTTGTACTTGCGAACTTGTTTATTTGGTCA
CTACCCAAAGCTCGTGACCATAGGTGAGGGTAAGAATGAAGATCAACTGATCGCAAGCTT
TGCTTTTTGGTTCAGCTTTATCTTTACTACAACTGACCAGTGGAGAGTCCGCAATACTGC
AGATGCCGCACCTATCCACCTGCTCACTTCTGCTCTATTCTTTCCTTGTAAACAAGACCC
CCTGCTTTATTCTTTCCCTACTTGTAAACAAGACCCCGAGATACTTAAACACCTCCACTT
GGGGCAGGATTTATTACCCAACCAGGAGATGGTTGGGTACTTTTTCTGACTGAAAACCAT
TTCTTTGGATTTGGAGGCTGATTAAACTGATTGTTCTCCCGGCTGCTTCACATTCGCCTA
CGAAACGATCCAGAAAGCAAACTTTAGTGATTTTTAAAGTATTGGTTATACTCACTTTGT
TTTGTTTTACATTCCAGGTCAAGCGGCATCTCAGGCTCCAGGAGCTGCAGCAGCCCCAGC
TTCTCAGCCTGGAGGACAGCCAGACTACAGCGCTGCCTGGGCAGAGTACTACCGTCAGCA
GGCAGCATACTACGGCACACCCAACCCTCAATCCATGGGTGCAGCGCCACAAGCCCCCCA
GGTACATCTCCATTAAAATCTGTCTTCCACGTGAATAGCACTGTTCGTTTTTGCGGCTGT
AACTCCCTTCCCAGCAGGTTTGACAGGGTTCCAGTGAGCGGAGCGGCTGCAGACACAAAA
CATTTTTTTTCTCCCTACACAGGTTTAAAGCTGAGTCCACTGTTTCTGCTGTTAACATGC
AATGTATGTTTTATGTATTTCTTTGCACAGGGCCAGTAATGTGAAGTGGACATAAAGTAA
ATGCTACATTGTCGAAAACAAAATCCTATGTTAAATGTTTGGATGCAGACGCCTTGATGA
AGATCTTAAATTTCCTTGGTTACAAAGTGTTTTACACAGATGGCAGATAATCCAGCGAAC
ACGTCCTCTTAATTTTTTCTTTTTTTTTTCTTGTAAATGCTCTTTGTTTTTAATAAGGTA
ACTATCCATATGGTCATTCCAGCCCTGTATCTACATTAAATGTGGTTAGATTTCATGTTT
ATTAAACTGTAAGACATTGCCATGTAAATCATCTCAGTTTTAAAATGCCTATTGCTTGTT
GTGTTTTGCAATAAACAAACTTAAAACTCCTGTGTGGTAAGTTGGGGTGGTTCTAAAATG
TGGGCTTTCTGCACTTTTTGATTTCTGGGTATGGATCTAAAAGTTTGGGTTTAAAGTTTT
TCAAAAAGATGACTCAGTTTTGCTGTCCTGTCTCTTCAACTGTCTAAAGGCTCGTAGAGT
ACTTGTTCACGTTAATTCCCAGTATCTTGTTGATAGAAACCTAATTGAATAATGTTTTCA
TGACCTTACTGAATTTAGGTTTAGGTTTCGAATAACGGCACATTTTCTGCATTGCTGTGG
TGTTTTTGGAAGTACATTTTGCCTGGTATGCTTATATTAAGGTAGTATATGCACTGTTTT
TTTTTTTTTTTGTTTTGTTTGTTTTTTGCCTTTTATAGACGCTTCCCTCTCCACAGGCAA
ATTTTGAAAAGTGGTAAGCAAGTGTTTTTTCTCATGTTGCCCGTAAAGTGGTTGCAATGT
TGCATATTTTTAGTGCTGTGTATGCATATATTTTTGTTCTTTTCCCAGGACAGTCCGGTA
AATTGCCATTGTTTAAAAATGTATTGAAACTTCGCATATGAAACTCCAATTTAATCTACA
TGTATATATTTTTCCCTTAAATAACAAAAAATGCTAATATCATTTTCCTCTGCCTATTCT
GTTAGTGCTTATCCAGAGTAAGCTCATAGATTTTAAAGGGCTGGGGGTGGCTAAGCAGTC
TTCACCCAAGTTGAGCCCCCCTGTGCTGTAAGTACAAAACTGGTCATGAGACCCACCATT
TTGACACTATCACAGCCAAACATGTAGTTTTTGTTCCAGTATTGTCAGTTTTTTCCCCTC
AGTGTAACTGGTAAGTATAAATTGTGATTTTGGGAGGAATAGTTTTGTTTTAAGTGATGT
TTGTGTTTAAATTTCTTGGAATTTGTTCGATTAGATCACTTCTTTGGGCAGTGTTTTTAG
TACCAGTTGGATTTCTGAACTAATGGTTTGAATGAGAGCACTGTATGAGTATTTCTCTAT
GGTCTTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1019, 1130..1290, 1479..1590, 1707..1783, 1957..2086, 2181..2196, 2323..2375, 2698..2760, 4277..4440, 4650..5008
1001..1019, 1130..1290, 1479..1590, 1707..1783, 1957..2086, 2181..2196, 2323..2375, 2698..2760, 4277..4440, 4650..4658
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved