Tetraodon_nigroviridis Locus rps8a
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rps8a
Tetraodon_nigroviridis
rps8a
Un
SNORD46, snosnR61
1148..1255, 1502..1569
4200
CCTGTGCTACATTTACTGAGGTTTTGAAATTCACGTGAATGAAGTGATCAAGCAGCAAA
AAATGTAGTTGACAATGAAGATTGTTAAATTATAAAATGTCAACTATACAACTAAAATTT
CTGTTCTAACTAAAAGATATCCGCATTTAAATTTTACATTGTGCCTCTCGGTTTAATTAT
TTAGATCCCGCCACCTTTACTTGTTCTCGCGAGAACACGTGGTATCAAACTTCCCCATGA
GCCCTTGCGTTTCCTCTTTCTAGCCGTCGCCTGAGAATGGGTATGTCTTTTTTGCTATGG
TCTGGGAAAGAATCCTCGTCCATCTGACGTTGTATCAAAGAAATATTTCGTTAGTAGTTT
GCCACCTTAAAGCAAAGTACTATTGAGATAGCTGTGACTCTAAATGTAAATTGTTTTTTT
TAGATTTATTATGTTTTAGCTAAATAACAAGGATGCCTGAATCTCCCAAGATGGCTGCTC
ACATTGGCTGTGTAGTTAGCTGGTAATGTAGAGAATTACCTTTTAAAACTATTTTGAAAC
ATGTTAGAATGTATGGTTAATATTTTATGCATTTCTTGTTTTTATTTCCCCCAGAGCTTC
TCCCAGAGAGGGAGAAGCTCTGGGGTCAGGTTTGCTAAAGGCTAATAACGTTAGCCATGA
TCGTGTCATGCTGCTTCAGAAAACAATTGGGAGATTTGATGAGCAAGTTATGGCGTTAAT
TTTGCACGGCCTTAGGCTTTATACATGAAAATAAGAAAGCTGGAATATGTTTGGTAAAAG
TTGATGTTTAATGTAAACTTCCAGTGTACTATTGGACGAAAAGTAGAATTCAAATTTGCC
TTTAAGAAATTGCTTGAGTAACATGATGACACTGTATAGCGGATTCCAAAATAATATGCG
GACAACCTAACCTTGGAGAACTGATTACTCAAGCAGAAAAATAGTTATGGTGGTTTCTTC
TGATATATCCAACCTAATATCTTGGTTTCACTGTTGTTTAAGGTATCTCCAGGGACAATT
GGCACAAACGCCGTAAGACCGGTGGCAAACGTAAACCCTATCACAAGAAGAGGAAGTATG
AGCTTGGACGCCCACCTGCAAATACAAAGGTTTGTTATATACATTGTATTAAATTTCTAT
CCCAAATTGGCGTGGGTGATGATCACTTGACCTTAGGTATGTCTTGTTTTGGGCCGTTTT
GGTTCAATGTTTGAACTTACCAATGAGAGGACTTGTCATAGTTACACTGACACGCGTTGT
TAATTGTTTCTACAGACTGTTACAAAGTTGCATTTAACAATTTGTTTTTTTTAAGTGCCT
CACATAATAAAACCTTCTTTGGTAGCTTGGACCCCGTCGTATCCACACAGTGAGGGTGCG
TGGTGGAAACAAAAAGTACCGTGCGCTGAGGCTGGATGTTGGAAACTTCTCATGGGGCTC
TGAATGTGAGTTTGAATGCTCTGTACTTTATTGGAACCTCAGATGCATTTGAGTTTTACA
TCTTTCAGTGATGATAACTTTGTCCAGTTCTGCTACTGAATGAAAGTGGTGATAGCAAAG
ACTCTGAGAACGATCTTGCATGTAGTCTATTGTATTTCATAGACCAGAATAAACTGGTTT
GACTTTAGCTTTGCTAATGTTTTGTCTACCCAGGCTGCACCAGAAAGACCAGGATCATCG
ATGTGGTCTACAATGCCTCCAACAATGAGCTGGTTAGAACCAAGACATTGGTCAAGAACT
GTATCATCCTTATTGACAGCCTGCCTTTTAGACAGTGGTATGAGGCCCATTATGCCACTC
CTCTTGGGCGCAAGAAGGGCGCCAAGCTGGTATGTGCAGATTGATGCTTCTTGATTTGTC
ATGAATGTGATTCTCACTAAATATACCTAAGAATACAGCCTTTGAAGGATGTTGTGTAAC
TGATAGACAAAGGCTTAGCTTGAAAGGTTGATTCATGCATCTTTAACAAGTTTTCGTCTT
TTGAGTCTTGCCGTTCTAAGAGAACAGTCCCTTTTTCCTACAGCAAGTCCTGATAACAGT
GACATAAGAGAAAGCCTTGACCTACACCAGTGATGCTGAAAGAAACTTTAAAAGGTATCG
CTCTTATAGTCTACCTAATAAGCTGTTTTGTACTGTAGACTCCAGAGGAAGAAGAGGTTC
TTAACAAGAAGAGATCCAAGAAAACCCAGAAGAAGTATGATGAGCGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTCGT
ATTGCCTGGTTAAAAAGAGGCAAATCTCATTTAAAAGCTCTTAACTTGGCAAAGTTAATG
AATGATGCTAAAATCTGTTTCTTCATTTGTACCTTATATTTAACCACGAAGGAAATTCTG
ACTTAACTTGGGTTTTACTACCCTCTTGCAGCTTGTATTGCCTCCAGACCTGGTCAGTGC
GGCAGAGCAGACGGCTACATCCTTGAGGGCAAGGAGCTTGAGTTCTACCTGAGGAAGATC
AAGGCCAAAAAAGGCAAATAAATGTACAGCTGTTGATCCATCAATAAATTCAAAATGCTC
CAATTTCCCATTGTCTTTTATTTATTTACAGAAGCATAAAATCCAGAAGCCTACATTAAA
ATGATTTGCTTATGTCCAAATACCCTTGAGTAAAATAAGGGATTGTAGCATCTTGGCTAA
TAATGGAGAAAAGTCAACCCTGACAGAAAACTGTATTTTGGGCTCTTTTGTCTGTGATAA
AATTCCTTGGACTATATTGCAGTAAATCACTTTTTAGTTCTGTGCCAATTTATGTTTAAA
TTCCGATGGTTTTTAGTGCACTGTATACATCCCCAATCCAATAGGATGTAGCATCAGTGA
AACAAAATATAAAAATCTGTTTTAAATGTCCAAGCTATGACTTAATACAAAACTGGTTTT
GTTTAGCCTGCCCTAATTTAACAGTATCTGATTGCTTCATTGAACCTAAGGCCTGTTTCA
AAATGCAGGTAGCGGAAGCAAGAGCAGCCAATTACAATAAAAGGGGGCTAAATTGTGTGT
GATTGATTATGTGTGGCATTTAGTGAACAAACACTAGCTGTTGCTGGTTCAGCCTTTTTT
CTGTTGGCGAAAATGTAAAAAAACTCAAACATTCAGAAAACAAAACAAACAAAGACATGC
ATGTATAACAGGCATTTAAGTGTTAGGCTTTTAGATAGACTATATTAAATACTGACAGTA
ATATAAGACTAAAGATTTGGCTTTTTCTTGGGGGTTTCTCTAATGAATTCTAGTCATCGC
AGGTTTAAGGACAGGATAAGCAACCCCACATGTATTAAAATCAAATATTACATCTTTGAA
GTGTATTTTTATATTTCATCTTGACTTTTACCAAGTTCCTTTTTGTGCTTGTTGGGTTGC
ACCGTGGTTTACACGTGTATGGAATGTCAAATTAGTAGAACGCTCAAGATAAAACTTTTA
ACGATCACCTATGGATTCGGTAAGCAATTTTCAGGCACACGATCTCTCTCTTGTGGTGTA
C
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 1345..1444, 1653..1828, 2138..2204, 2938..3000, 3091..3200
1001..1108, 1345..1444, 1653..1828, 2138..2204, 2938..3000, 3091..3200
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved