Tetraodon_nigroviridis Locus ahcy
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis ahcy
Tetraodon_nigroviridis
ahcy
Un
SNORA17
3386..3516
8804
gggagggtctcctgattaattccctttgcataacgaacaacacaaaacaaaacaaagaa
aaggaaagaaaaaaaaaccggatatctataacctactcagggcttgtatcctccttaaat
acccaaataccatctgccactctttcctttccgcctttagcctcagtatgtccctaccat
atctacttttagcgttcttaagtttcaccaccagcttcttcctttcctcgtcatacctct
cacacccaaacaggatgtgttgcactgtttcctcctttgagcagctacgtttcccggttg
gacgcttccctattctaaataatgacttgttcagctccgtatggccaaatctcagccgag
agatcactcttgcttccattcggtttcttccggatgtcgtcgattctccaaccttccttt
ggattgtatagaaccaccttcctctcctctcctctcctctcctcatcccactcctttcgc
cacttttcccttattctctgctgaaccccgtctctcattagtgttttgctgagtctagtt
gtcatgccaatgttcgtgtatcttgtcgtctcctttgctttcttatctactaactcgttt
cccccgaccccccctgtgtgctggcacccaaagacactccaccaccggacccgtcatctg
aattccatacagggtttgctgtgtgtgtgtgtgttaagaggtctttcctgctttctgcgt
ttccgtgctgcagtgtcattaatgatgagctagaatctgatcatatcactgatctaaacg
gtctaacttcctctatcaaaccgaaagtggagagcagctcctcccatacgtccgccggta
accaatcagacctgcgggggcggtggccgcgaggcgaccaatcagagcagcgcgccgctg
gcggccgcagccaatcgcagccggcggaagcgaagctctccgctgcctcgaccggatcca
gcgtcgctccacaataaaacgcggccgtcatgcgcctcggcCCCTCTCCGCCCGCGCGCC
GCCTGTCCTCCACAGCCCGGGTGCGAACACACCAGAGGAAGCATGTCCGAGAAGCTACCC
TACAAAGTTGgtcagtggcgactcttaacggtgctcacgagatcggcttgtgtcacacat
actcgtgttcggttaggcttgcggaggaacttttgaatatgttcatatactactagtact
agtaggactactactaaccatcctgcagccttgctatagctcgacttaaaaaggtcacaa
gaaaataaaccgtatctgtttaaagctgtattgtacaatagatcaaagacatgtcttcgc
cgtatcactctggttgtttgcccagactggctgttgctgtttgctgtattctacctcagt
tcgttgataaatgcacattcctcctttggggtaataactgttcttacaaacggaaaaatg
attaggtcggtaatattaggcgctaaccgggattagatggcgaagctgaccccgccctca
agggctgctggggtttgtagttcgttagcgcggatccacgttggtcgcgagcgccacgaa
aactccagttcccatgatgccctgcggctcgagcggagccaagctgctgccgtataacgc
tgagaccgcacgtggcgtcgcgtgctgccatatatgttataaacgattttacaacatggt
ggccaagaagggttttttttgaaataccaacaaacgtctcattatacattttagttagtg
agacgtattttaatagtttgactcttttcgttgaaacttggccgccatctagttcctctt
ttcatttagaagtaccgttattccttatacttctagatgttatcgatgcagaacatttgc
gaggtgtgtgtgcttgctgttaccgggttcgaggtttccggccttccacatgcttgggca
gccgcctgtctgctgcttgtggacatgttccaggccaaacctgctgttaggagttataac
aggtggctgctgctactaaagaataacagtggcagatattacgtttatttgtaattcacc
tggcctattcaacacaaaggtcgtagctttgtatagtgtcatggttggttgtttaacctt
ttgaccccaataatgagaacggtcaaggatagattgataatgtttcgctacaatctgaat
ttaaaaaaaaatctctttgcttattccagtttactgtgtttgtggagcatgaaatatata
tgttgttggtatcttttagactaaggtagggtttgtttgtttgttttttttaaaaattta
aacacagtcacatttaaataatgtttatttatttatcccccccccccatgtgcagCCGAC
ATCAGCCTGGCTGAATGGGGCCGCAAAGCCATCGACATTGCTGAAAATGAGATGCCCGGG
CTGATGAAGATGAGGGAGATGTACGGGCAGTCCAAGCCGCTGAAGGGCGCGCGCATTGCT
GGCTGCCTCCACATGACGCTGCAGACCGCAGTGCTCATCGAGACCCTCACCGCCCTCGGG
GCCGAGgtaggaggttttcctctaaaatgttccatttttaacgtttttattttttaaacg
agaaaaataatattcacaaacggatggtgcagatccgctaagcagcccgtgcccttgtct
ttacccttgtggtcaaacattttcaggtcctgttgaacattttggaggccaaacagctgt
ttgtcatcgcctcagctcaggcatcacatagatgggcgatctgattataaatcaccaata
ttccgttatttttaattactaatgtcagttagggtgcagacgagcagacttttgtggaaa
acctttgaggacattgcaccttgtgcaaaaaaaagaaatgtaaagataagcatacccccc
ccaccagccttgcataatcaggaccgttgagagagttttagtggcctgtttgttgggact
ttagccccgactgtctgccaggtcacacggcagagcggaaggtgattattgacacggtga
ccacgtctccgtggcgcctgttacacgcgtgtataggcagctgttaacacatcagcagag
tgcttctgtgtggcgcgttgaagattattgaaggggaccaaatacctgagaaacgatggg
aagtaaattcagacataaacctgacatccaaaatgtttttgttgcaataaaaatgtatag
actggacattctagttcatgcaaacggtaaaagagtcgctctgagatctgtgtttgcgct
cttctgagctcaggtgtcgctcttcctcagGTCCAGTGGTCCAGCTGCAACATCTTCTCC
ACCCAGGATCACGCAGCCGCTGCCATCGCCAAGTCCGGTGTTCCAGgtacagccggccac
cgctgcctccagcggcggggctgacgggtgccccttgaggcgttgcagcccaactgtccc
tgttggagctgtgtcacgaggtggcagagagcacgggtggtgttctccaccgaggctccg
cacgtggacgcctcggaactatttcaccaccaacatttcatccttcaccaccaagcgaga
accttgctgagcgcgtctgcttctgacctgggcgtgtcggtgttttggttgctagTGTAT
GCGTGGAAAGGAGAGACGGATGAGGAGTACGTGTGGTGCATCGAACAAACCTTGTACTTC
AAAGACGGCCAGCCCCTCAACATGATCCTGGACGACGGAGGAGATCTCACCAACCTGGTG
CACCAGAAGTACCCCAAGTTACTGGCAGgtcagtgctgtctctgtcctctactcctgttt
ctgtccactactcctgtctctgtccactactcatcgttagtctgtctttgtctgtttttg
tctccagtttttagtctgtctctgtctctcgcctgtctctgtcccagtcccagtctgtct
ccgtctctgtataaacacaacagttgtagcagttttactctgttgacagcaagtttccat
ccagtcctgctcaatttgtcttccctcgtctccgactgaaggtgtttttcctgtgttgca
ccatttgcagagccaagcctgatcacatgtcaagaatgtgtcggctccatcaagctttaa
atgtaaatatcgctccccaggtttcctctgggacaccgaccgtcctcgtcctcgtcttca
tcaaagatggccaggagtgtttaaaattgccgctcactgtttgacgtttgagcatacgca
cgtttaaagcttgaaaatgtgcccttgacccctgtctaatttcaattaattctagaaacg
gacggaacaaagcgtatttctgggctccaggtgtgctttatggaactctgctgatttgtt
gccgtccctcacatggaagcgcagaagcgtctgcatccaaaaccactttggtaacgggtc
tgaatgtgcttttcagGCATTCGCGGGTTATCGGAGGAAACCACGACAGGCGTCCACAAT
CTGTACAAGAAGATGAAGAAGGGCGAGCTGAAAGTTCCCGCCATCAACGTCAACGACTCC
GTCACAAAGgtagcgcccccgtttcgccgctcacgcgcaggaagtcgggattcgtgacgt
cggagctcacgtatgtggcgtttgtgtgttgcagAGTAAGTTTGACAACCTTTATGGCTG
CAGGGAGAGCCTGATCGACGGGATCAAGCGAGCCACAGACGTGATGATCGCCGGTAAAGT
GGCGGTGGTGGCCGGTTACGGTGACGTGGGCAAAGGCTGCGTCCAGGCCCTGCGAGGGTT
CGGAGCTCGCGTCATCGTCACGGAGATCGATCCCATCAATGCCCTCCAGGCTGCCATGGA
GGgtaagtgatgtcagaaggctcctcagataaatgactttgatccttgctgcttatttgc
tgtgtttggaagtccaggaagaactaaggggcctcgggagagctggatcttacctttgac
ctggacctggagaatctgtaggctttgtttaaatcggaggtggacaaactgaggcccggg
ggcctcatgtggctcgatgaactatctaatctggccccgcagagcttttacagccatttc
tctagaagccaaagggagagggttgtcagcttggtcggttggaaaatggttcagaccccc
ccttcagctagcatgctaacccgtcccctcaagaaggcggggccaaacatcatttggagc
ttgattatccatctctagttggacccatttacaggctcttctgcatgttttctcagtcag
tcgtccgtccagcaggatttttagctaacctctgatcctcatgtggaaggttagcttcct
gcaccacctgatcagcctcttcatcaagctctaaaaccgaacgtggcccctcaggctgaa
taattgcccacctttgagctaaaccgatgcccctgacataaatattctgatactttagca
cttgagctgcttcttcggttctttggagtccactcaggtgcttgtctgtggccttcaggt
cggtacggcgcctcaccaccgctagccgtttgatcaagaggacaaaaagaagacactgcc
tagagagctccctgagctcctggcgtgcacgtgccagaaagccccactttgaaatcttag
tgttatgacagagaggccggacaggagcctgaaagctcacctggagtttacaaaatggat
gaaaacagatggagcttcttggctttgatcagggtcgggggcgtttgtgcgcctgggttt
ctgttgatgctggctgggaaaggtccgtttttactccgtctgactgctcgtaaacgctct
acaacacaacccatagccagaaacctgctagccaacggatccagtttgttttcagagtct
ttattgtacccataattcagaagcacaaagcaaacagacgtcggttgctttcaagttggc
agcgcgctgctttgctagggtggtccaagccagtgcagatgagcttgttggtggtgcacg
ctggcagagggcagcgtggtgagatagttatggcgtagcacgcacgcgggtcaatcacag
gccctcgtcttgtgtgcgttggccagtcgccgatattacaatcggcgacattgccatggc
aaccgcaccttgtttacatctcattttgcatggattggctgcaggctttggctaggatac
tatgctatggctacatgtgaataaaatggctaatctacggttactgcgaacatggaaacg
aatcgggattgacaaatatagtaatattcgtgactagaccagcaaacgccgtcctctggt
gattctcgctccctttggccattttatcgtccttcctggcttctgggagcggatcggtgg
gcttggtttcagagcggggagtttgtcagtggctaagtcccgccggtctgttgtcgccta
gGTTACGAGGTCACCACCATGGATGAGGCGTGCAAGGAAGGAAACATCTTTGTCACCACC
ACCGGCTGCGAGGACATCATCCTGGGACAgtacgtccgtcccggacgagcaggttggcgc
cgctaaacgccagcaggagaagctgacctgagctttctctctgcagCCACTTTGAGGCCA
TGAAGGACGACGCCATCGTCTGCAACATCGGACACTTTGACTGCGAAATTGACGTGAGCT
GGCTAGACAAGAACGCAGAGAAGGTCAACATCAAGCCCCAGgtaggaaacctctagtctg
ccttcatccaaccgtcggggcggttgggtgacgctccagctgatccccctctgcgtagGT
TGACCGCTATCTGCTGAAAAACGGACGGCACATCATCATCCTGGCCGAGGGCCGCCTGGT
CAACCTGGGCTGTGCCATGGGACACCCGTCCTTCGTCATGAGCAACTCCTTCACCAATCA
Ggttcggccaggcgacgccccctgagagaaggaacccgggaggttgggttctggtcagct
gacccgctctcgctccccacagGTTCTGGCTCAGATTGAGTTGTGGACAAACACGGACAA
ATACCCTGTCGGAGTCTACTTCCTGCCCAAAAAGgtgggaaactcattcgtgttgtatgt
atgtcaagtagcatatgtgcagtccaaattctacagcactcgctaagctaagagcgatga
agccaggttgcaataaagaaggcgtagaccaggggtgggcagagatcagagaaggttgag
ccggtaagctggtccaactagagatggatgatgaagcttcaaattggttccaccttcttg
agaggacgtgattgtaaagaatctgtgggccggattcaacagttcatcggaccgcgcgtg
gcccccgggcctcagtttgaccacctcagacgtagaatagctgcgatgctttatgtcata
aagtgatgcaaacctttggagacgtttacagatcaggaccctccaggctcgcgggaggac
ggctgcttgtctaatctgcgttttcagcggtagattgtgtgtggtctcactcgtttctcc
tccttttagCTGGACGAGCAGGTGGCTGCCGCCCATCTGGACAAACTCGGGGTGAAGCTG
ACCAAGCTGACGGACAAGCAGGCCAAATACTTGGGCCTCCCCACCGAGGGGCCCTTCAAA
CCTGACCATTACCGCTACTGAGAGCCTTCCCCCAACGCCAGAGGAGAGAGACGTTTCTTT
GGAGCGCTGGTGGAAAGGATGCTTTGCTGTTGCCGTCGTCAAGCCTTCCGGATGTGCGCA
GAAGTCGGACAGATCCGGTTCTCTCAGCCTTCTCCCGCTGGTCCCTACTACTGAAACATC
AGGTCCTACTGCTGAGGAATTCCTACTGTCATTCGCGCTTTTATGAAATAAAAATCCGTA
CCATAttggcatgtgtgcttcttgctagccagcctgctcctcctttagcgtgttgaacct
caactggctgcaggcggtcgtgctggtgttgcttagcgctgggagaccggcctgattccg
tagccgtgtccaaccctttctttttggagaactgttttttaaaaaatcctaatagaattt
aaacatcaaggacgtcctgaaagtgccagcggcactgggaccaggcgcagctaacgtaat
aaagaaatcagccgctttcagtccagatgagtttacagaaaaagcagcagagcatgtggg
gctctaatggaggccagttggagctggtcctcattcaggccttccccctcagagaacatc
tggtccaggagggagtctaggtggtccacctcagcctggtgccccctgccctccgggtca
agggcacgccggcgccgccctggaaaagggcccctgctccggccgtgcctgcgctccacg
cgtgcacgtgcgacagcggtgaacctgctgatctccgggtccagtcggaaccggtttgga
gggtccggtggagaccagacagagctggtggcagcgcttccatctacgctgacccactta
gaccagatcccctctaaacggtcatttaggtgttttactaaccttccaagtctcatttgc
aacatttttaatatttatattcaaacaaccatttaactgtctttctataaattcttcact
taaattctttacataatattgatgtaataaagtcttttccaggatgaataaacatgctga
ggagctgccagcgtcctgtaaacacgtgaacacgtagatcatccacgccggctcagcgtt
tagtcgatgattagcaaacttccagatgagcaggatcaacaggctgccaagcagtttctg
cagattccatcaaatatacagcaaatacagcagatgagtgagcacaaaaaccctctgcaa
atatttgctgtaatttagaaacaaatattgtttgcgtttttgttt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1089, 2335..2525, 3270..3345, 3595..3747, 4396..4508, 4594..4801, 6361..6448, 6526..6640, 6718..6840, 6922..6993, 7449..7804
1062..1089, 2335..2525, 3270..3345, 3595..3747, 4396..4508, 4594..4801, 6361..6448, 6526..6640, 6718..6840, 6922..6993, 7449..7580
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved