Tetraodon_nigroviridis Locus pdha1b
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis pdha1b
Tetraodon_nigroviridis
pdha1b
Un
SCARNA16
3804..3962
5791
GAAGGGAAGTACATCCAGGTCAGAGTTCACAGTGAGGTTTTTGACCCACTGACACGCCA
GCACAAGACCACCAACGTCTTCCATTTTACCTTTATGTCCGACCGTGACGTCCCCAACAT
CATCCCAAAGACATATGGAGGTAAGTGCACGCATGGTGGAGATGGCAACACGTGAACAAC
TGAGATGTGTCACAACATGCTTGTGGATATAGTTTGAGTTTGCTGTTTTTTGTTTTGTCT
GACAGAATCAATGTTGTACCTGGATGGAAAAAGACACTTTAACCAGACTGTGGGACACTG
AATGCAACATGTCCACTGCCCGCCAAAGCCTTTATTCATTGATCAAAAACGTGCACACAC
TATATAGTGTATGTTTTGAGGTTTAATAAGGTGTATCTTCTTTTATCACTTCTGTTCTGT
TTACACACTCACAACATGGAGGCTTGACTTTGTTACCTTATTTTTGGTGTTTCCCCAATC
TGTTAACACTATCCGAAGAGTTTGACACATTTACAGAACAAGCCATTACCTCAAATATTT
ATGCATAGCTTTTGTTATTTTAATAATAAATACACCATTGCTGCTTGTATGCACAGAACT
AAATTTGATCTTTATTCTTCATATTCGAGATGGCTTCAATATAGAAAACGTTTTGATTTT
TCTGGATTTTATTATACACAGATGCAATCATTTTCGCTAACTTAATTGTACTATGCTGCC
ATTTTTGATCGTGCTTTCCCCCCACTGTCAAAAAATTAAAATTAATAGAATGCTTTTACT
TTGCCAAGCGAATTGAACGAGTTCAGAATTTTTCTTTTCAAAGAGGACGTCGACAAATGT
GTAAATTATCCATGTAAATCGCGTCTACGGACATAAAAGCCAGGTCGGAACCATTGTTAC
CAGGAAAGAGTCGGGAAGCGTTTTACACGCACACCAGCCGTTACCGCGGACAACTTCCCT
CTGTGCTAAGCCTCTTTGGAGTTAGCTCTTCTTTTAATAGCATGCAAAATATGTTAACCA
TGATCTCAAATGCACTTTGTAAGATTACGGGCAGGAATGTGGTGAGTGTTTGGCTGGCTT
CGAGCTGGCTGCGGATGTGCTAATGCTAACCGGTTAGCTTTCTCGAGTTTGTTTGCTACC
TTCCTGACCTTGTGATGGAGCTAGCCTCACTGTTTTTCTGCAATCTACATGTGATGGCAA
TATATACATGTTATAATGTCGATTATTCCTTTACACCATTTTATAAACTTTGGATACATG
TCGACGATGTGATTTTTTTCTCGGTGTTTACTGTGCTTTGTGTGTTTCCAGCAAAGGCCT
ACGGTCCGGGCGAATAATTGGGCACAAATCAGCTTTAACAACTTCGTTTTTAAAAATGGG
GTGTCCACAAATTAAATTAACTTTAGTTGACTGTCATAAGTAAACAAAGCCAATCGTAAC
ATTTTGAATTAACACGTGGTCACGTCGTGAAAATGACGCTTTAAACGGCGTTTAAACATT
TTCAAAGAGGTAAAAGTAGGAAGTCCGTTGCCTAGAAACCTGTTTTTCCCCTTTGGCTTC
GGCTCCCTAATTATCCACTCTCTTTCTCCCTTGCATACGAATACACAGCAACAACCCCCA
CTTATGTCTCGCTTTTTTCCCTCCTCTCCCACCTCCTCCACCCCTGGTCTGATCCGTAGG
GAGCCCAAACAGTGTCTGAGGTAAGCAGCTGGTTGCTCTGCTCCTTTAGGAAATAGGAAA
TTAGTTAAAAATCAATCTATAACTGCCAACGAAGACCACATTTTCTCAAGTCCTCGTAAA
ACGCAAGCCATCAGCCAAGCGTCCGATCTCCTCGCAGACGTCTTTAATATTTTTCTTGAC
CTGTTGAAATGTCAGTGTACATGTAGACACTGTTGGGCTGTTGCCTCCATGTTCTCCCCA
TGTTTCCCCTGTTTCATCCTGTAGGTGACCCCATCCTGTGTGTTTCCATCCATGTGCCAC
CTAGTTGCTGCCTTCTGTTCTCGCCTCACGGGCTGGTTCTTCCGGCTCTTCTCTGGTCTG
ACTCGTTGGCTCCTGTGTTCCCCAGTTGCTGATTGACCTGTCAGAATACGTCAATCTGAC
CTCACCGGTGGAGCCTGCTGTGCCTCGCACTCAGCGGCAGCCTCCTAAGCCTCCTCCAGT
CAGTGCTAAAGCCACATCAGATGGCCAGTTAGTTAGCCACCTCGCCGGCCAGCTAGGCAG
ACCAGTAAGGACATGCGTAGCCTCGTCTGTCTGCCTGATCACTAACGGGGGTGGGAAACA
GTCGTGTCTCTGCAGCTACACCCACATTATCAGCTGCCTTAACTCATTTTCCATTTTAAC
CTGACTTGTGTGCCTGGCTAATGGGAAGATGTTTGCTGTGCCTTGCTGGGAATGTGAACG
TAGCTCCAGTCACATCCAGACTAACTGTCAACAGTGGAGCCTCATGTAGGAGGTGGGGGT
CCTGTCCTGTAGCCCAGACTTCTCTGTGCTGGCTGCTTGCATGGAGGTCCGCGGCCAGCC
TTTTCCTGCGCAGTGGCCGCCTCAGTGAGTTTTTGCTTGCTGCTGTGTTCCTCAGGGCGC
CAGAGTGGTCGTTTCTCGCTCCTTCACTGACTTCACCCCTCAGGTCACCTTTGACATCAA
GGTAGGTGGGTTTTTTTTTAATCAATAGGGGAAAGAAACTTGTTGAAATCTAATCCCACT
GTATTGGCAGAAGTGCGACCTGCACCGCTTAGAGGAGGGCCCTCCGGAGAAGGCGGAGCT
CACCCGGGAGCAGGGCCTGCAGTATTACCGCACCATGCAGACGATTCGACGCATGGAGCT
GAAAGCTGACCAGCTGTACAAGCAGAAGATCATCAGAGGGTTCTGTCACCTGTATGACGG
ACAGGTGAGGCCATCCTCAAGTTTCACAGGTTTTTCTAAAGTCTGCAGACACAAAGATGA
TCAAATTCCCCGAGTTCTGAGTCAGATTTCAGTGGTCTTTGTTTAATTTAACCAGCGTCA
AGCCCGTCCAAAGGTTTTCTGCCTTCTTCGGTGTTGCAGGAAGCTTGTGCAGCAGGCATC
GAGGCCGCCATCACGCCGAGCGACCACCTGATCACCGCCTACCGGGCACACGGATACACC
TTCACCCGTGGCGTCTCCGTCAAAGAGATCCTGGCCGAGCTGACGGGTGAGACGGGCGGA
ACGTTCCCAAGCAGTCTCGTCCCGCAGCGCCTTCACCGCTCGCTTCCTCCTCAGGTCGCA
GAGGGGGCGTGGCCAAAGGCAAAGGGGGCTCTATGCACATGTACGCGCCTCATTTCTACG
GAGGCAACGGCATCGTGGGAGCTCAGGTAAACGTCCCTGGCTGACACTTCCAACATGCTC
AAATAGGATTAATAAGAACCTCTGAAACGGAGCCGGGCTGTGATTCGTTTAGGTTCCTCT
GGGAGCTGGAATTGCTCTGGCCTGCCAGTACCAGGGAAACAAGCAGTTGTGTGTCACGCT
GTACGGCGACGGCGCAGCCAATCAGGTAAACGCCCACATTCATATCACCTCGTGATGCGA
TTAAAACATGAACAAGACAGTTTGGGTTTCATTTTCCGCTCCAAACCGATCAGGGCCAGC
TGTTTGAGTCCTTCAACATGGCTGCGCTGTGGAAGCTGCCGTGCATCTTTATCTGCGAGA
ACAACAAATACGGAATGGGCACGTCTGTGGAGCGAGCGTCCGCCAGCACCGACTACTACA
AGAGAGGAGACTTCATCCCGGGGATCAGAGTGAGAGCCGAGCCTTGCCGTCCTTTCTTTG
GTCGGGTGTGTGTGGGTAACGGCTGAGGTTTGGGGCAGAAGCTGCAGCGCGTCTCTGCCG
TGCGCTGCAGCCGGCCTGGAAGAACCGAGACTACAACAGGAAAAGGCGCAGCCTGTCCTG
GCAGTTGCAGGTGTGAGCATCCATCCAGCTGTTTGGTGCTCTTGTATGATGCTGCAAACA
AACCAGAGAAGCTGGATAGTTCCTCCGGGTCTGCAGTGATGGCGCCGTCATGGCCGAACG
GCGATCCGTTTCCGAGCAGTGTCGATTCCACCGTTCCCCTTTGTCTCACAGGTGGATGGG
ATGGATGTGCTCTGTGTCCGAGAGGCCACCAGGTTTGCCGCAGAACACTGCAGGTCTGGA
AAAGTAAGTTAAGAGTATTTGGAAAAGATCAGGATGAGTGTAAAAGTTAATTAAATGAAA
CACAGCAAAAAGAGCCTGTTTTTGCTCTCAGGGCCCCATCGTCATGGAGCTGCAGACTTA
TCGTTACCACGGACACAGCATGAGCGACCCGGGTGTCAGGTGATTGTTTTGAAGCATTTC
TGTTATCGGGATGATGAAGCTGTTTCGGTGAAGGAAGCAGACTTGCAACATCAGCCTGTG
GGTAGCATCAGTCAGGTTTGCTCCAGCTCTTTCGTAACTGTCTGCAGCTACCGCACTCGT
GACGAGATTCAGGAAGTGCGCAGTAAGAGTGACCCCATTTCCATGTTGAAAGATCGCATG
CTCGGCAACAACATGGCGTCCGTGGAGGAGTTCAAGGTACACCTCAGTTCACGCTTGAGG
ATAATCAACCAGACTAGCGAAGAAAGGGATGAAATGCTCGGAGAGTCTAACCTCCCTGAT
CTGACAGGAAATCGACATCTCTATCCGTAAAGAGGTGGAGGAGGCGGCTCAGTTCTGCAC
GTCCGACCCCGAGCCTCCACTGGAGGACCTCTGCAACCACATCTTCTGCAACAACCCGCC
CCTGGGGGTCCGTGGGACGCACCCCTGGGCTGTCCTCAAGTCTGTCAGCTAGAGCCTGAG
CGTGGCTCAGCTCACTGATCCTCGATTCTAGATCAATATTCTGCACCTTATCAGGACCAG
GAACCTGTCAGTGTTATTTATTTAATTTATTGTTGTCCTGTTGTCACATTGTCTGTGTGC
TGGGCCGGTTTAAATATTACAAAACGCACAAAGGTCTTTCTCAATGTGTTACATCAGGAA
ATGAGTGTCTTTGTTGGAAAGATAACCTCAAATGTCTCAATGCTGTTTGTTGTTGCTGTC
GTTAGTGTTAAATTACAGCTTTGGAACTTCATTTAGAATACGGGTTTTAAATATCCTGCG
TGATGAAACGTCAGCATAACCAGAAAATGTTGTTAATTGTCAGGAAATGATTTAAAATAA
CACTAAAGACTAAAACTTCTTTTCAGTTTTTACTAATATATTTAACCTTTACAGACATTC
TGTATTATTGAAGCTATAATTGTCCACATGTTTACCTTCGAATAAAGATTTTTAAGTATT
CCTCATTACTTTGTAAATGACTTCACGGAGATTTGGTTTTTTTGGTCTTATCTCCTAAGT
CAAGTGTGGTTCAAATATTCCGTATTTGTGTTCTAGTTACCATGTCAGTTTTGCTTCTCA
GGGTAGAAATTGAGCTGTTAAAGTATACTTTTTAAAAAAAATTTATTTTGCACTTTCAAG
GTAATAAATATGCATTTTAGTAAAAACCTTTCCGGTCTTGAACTTTAAACCAGGAGGAAA
AACAAAACTTGCCAGTAAAAAGATTTATTTTTCGAAGTTTTCAGTGCGGGGGGAGTTCCA
CTGGCGACCACTAGATGTCACTGTCGGAATTTAGTTATTTAAACTAAAAATCAGTACAGC
AAACAGCCCTTAAAAACAGCCCTTAAACTAAACGGCCCTTAAAGAATTTGAGAATTATGT
TTCCTGAAAAAAAACATACTTTTTTCCTGATTTCTGACCACGCTTATCCGCAACATTCTA
ACCAGCGGAGAAGAAATCAGCCTACGTTTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 2575..2640, 2710..2883, 3039..3165, 3234..3325, 3412..3504, 3593..3748, 4071..4142, 4231..4298, 4427..4535, 4627..4791
1001..1060, 2575..2640, 2710..2883, 3039..3165, 3234..3325, 3412..3504, 3593..3748, 4071..4142, 4231..4298, 4427..4535, 4627..4791
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved