Tetraodon_nigroviridis Locus rps5
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rps5
Tetraodon_nigroviridis
rps5
21_random
SNORA3, SNORA3
1804..1936, 2847..2930
3647
TTGGAGCTGTCGTAGATTAGGCCTTAATTCTTCCCAACATGCCTCAGTGTTTCACGTAC
CATACCGAAGTGCTATGTCCTACCGCCATTAGTATTATTGTAATAATGAAGAAAGCATGT
ACAGCTGATAGGTAATTGTTCTACGTGACATTGTTGAACTCCCATTGTGTTTAGCTGTCT
GGGGCATTTGGTGGGTCGTCCTTGTGTAGACCTGTATCACAACAGCCATTTTTGCAAGAT
TTATTTGAGTAATCACAGCTGTTCTAGACACTAATATAATGTTAAAGGTGCTGCTCTGTG
CAGGTTGACTGATTTCAAAGACGTGTCAGTACAGGAAAACCGCATTTTATTTACATCTAT
TATATTTGCACATTCATGCAATATGGCTGCTTGTGAAAAAGGTATATTTTCCTTTTTTTC
TATTGTTGCCCACTATATATTATCTTAAGTGTATTCTCGAAAAAAGGATTTTTTTATGCT
GTAATAATAAACAAGGGATTTTTAAAAGTAAAATATCAGTTTTGCAGTGTGCAATTACAA
AAGGGAGATAATGATGAATAAGGAAATAATTTTAACTTTACAAAAATTTTATATTATGAG
CATTATTTTATTACTGTTTAACTGTCTGTATTTTCTAGTTTAATAACTCCAATTGCATGG
TATCAAGATGTCATCTGTGTTGAGATTTCTTTTGACTTTGTCTTCTGAGTAAATGTTTTA
CTCTGAAAATTTCCAAAGTATTGAATCTGCAAATGAAAATGTGTCAGATATAGTCAATTT
CTCAATAAAATGCATTTTTAGACTTGTCATTTATTACAATGTCCTATCCTAGATGATAAA
ACTAATCTAAAAACATTTTCTAAATAAGAATCGGTAATGATCAGTAAATTTGTACAATAT
ATTGCTGTGATGTAATAGCTCAGAATGTGGTTTATTGTTAGGTATTACTTTTGTATTAAC
CGTAAAAGACTCTAATTCCCTACATCCCTTGTGCACCGGAAGACGTTCCAGGTTACCGGA
TATCTGCACGCGGCGCCCCGAAGCAGCCCTTTTCCGTCTCTGAGAAGTGTGGTACAGAAC
GGCAGACAGCAGTGAGTGGAAAAAAAGACAATTTTATCCATCATAACTGTGTTAAAATAG
TTATTTAGCGACAAAAGATCACGCGAATACTTGCGTTGAACAGAGACTGCTAGAAACATG
TCCTGTTTGACTATAATGTTGCGCTAGTTGGATGAATTCCGGCGAAGCGAGCAAAAGTTA
ACATGTCACTAGCTTGCTAACGCATGTGGATGCGGCGTGTTGATTAGCCATTTTAATCAA
TCTCCCAAACAATGAAATTTTGAATACAATCTAAGCTACATTATCATAATTGTTGTATTT
GAGTCTAATAAAATATCTTATTCTTAACGGTTACTTTATTTTGCTTCCGCTGTCTTGTCA
TTTTGCTTCGGTGTTGCTAAAGCTAGCTTAAGCTACGTGGAGTGAAGCAGGCTTTTACTC
GGGCCTGCGGTGTAACTGCGGTTTAGCATCGTATTCCTTTAGCCTTCATGTTTACAGTAA
CAGTGTTCAAAACAAACACGCATATCTATGAAACAAATTCACAAATGTCATTAACGTAAA
TAGATTCTTGAATATGAGTTTTCTTTAACTTTTCAGTGACTGACTGGGACAATACCACGG
CCGTGGCTGAGACCCCTGAGATTAAGCTCTTTGGCAAATGGAGCACCGATGATGTCCAGA
TTAATGACATCTCCCTGCAAGTGAGCATCAAAACAAGATAGATTTTGTTTTTCTTTTTAC
GATGCGTGAGGCAAGAGTCACTCCTGGACATGGATTTGTTGGCCTGGTGTGCTATAGACC
TCGCAGAGAAAATGTCTTTGTTTATTCATTGACTGTAGTCTGTTATGGTCCAGTCAATCA
CCAACTCAGATACACGAACTTTTTGTACTTGTAATATGCGGATAAACTTATTTTTAATTA
AGGGCATCCTGTAATTGTTTCCTGTTCGCTCCAGGATTACATTGCTGTAAAAGAGAAGTA
TGCCAAGTACCTGCCACACTCTGCAGGACGATATGCGGCCAAACGTTTCCGCAAGGCCCA
GTGTCCCATCGTGGAGCGTCTGACCAACTCCATGATGATGCACGGTCGCAACAACGGCAA
GAAACTGATGACTGTGCGCATTGTCAAGCATGCCTTCGAGATCATCCACCTGTTGACTGG
AGAGGTGTGTTCCTGCTCATAAGATCTTTTGGGGTCTTTTTTGAGTTGGACCGTATGTTA
AGATTGCTGCATTAAGCACATTAAGTGACATTAAGTGTGTCATTGCATTAAAATGGAGAA
CACCTACAGAAGGTACTGAAACTTCAATTAAAAACATGATCCATGTTGTAAATATTCTGT
GGAGGTTACAGCTGCGGGGCCAGCGCTCTGAAATGCTGGGATTGGGATTTACATCTGTTC
CTGTTGGTTTTGCGTTAATAGAAAGGATTTAATATGTTGACTTTTACTTGCAGAATCCCC
TCCAGGTTTTGGTCAATGCCATCATCAACAGCGGGCCCCGTGAGGATTCCACCCGTATTG
GTCGTGCAGGTACCGTCAGGAGGCAGGCCGTCGATGTGTCACCCCTCCGTAGAGTCAACC
AGGTAATATCCATTCAAAAAAATGTGTCTTTATTGCATATATGGGTCTTCCACTGTTTTT
AGTGTACAGCAGATAAGTGCTAAACACGTCCATATTCCCTACCTGATGTTTGTGTGAAGA
TTTTACAATCGACTGCATGCGTGTAAAACTCTTGATAGTTGTTGCTGGTATTTTTGCGTC
TTATCCTAATAGGCTACAATCTGGAGAAGCGAGGCTAGAGTCACGCCTGAACACAGCCCG
TTGTCCTGGTGTGCTAGAGCACTCGCAGAGGAAATCTTTGCTTATTCATTGGCTGTAGTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1090, 1656..1759, 2014..2223, 2513..2647
1090..1090, 1656..1759, 2014..2223, 2513..2647
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved