Tetraodon_nigroviridis Locus Poly:SNORA9
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORA9
Tetraodon_nigroviridis
Poly:SNORA9
21_random
SNORA9, SNORA9
1001..1135, 1342..1472
2473
CATTCGCTGAGTTATTTTGCCGGTTTTTTTGCGTATTTGCGGTTTGTTTTGTATTTAAA
TGACGTCAAAAAGGGGAAAAAGGCTGTATCTAAGAAACCAGGGATTCTACTGCCCTCTGC
TGGGAGAACTCACGCATAACTGAAGTCAGTGAAGAACGCAAAAACAACAAAATATGTGAC
CAAATAAAGAAGTTAATCTTTTAGACGGTGACTCCAACATACTATTTGGTGAGTAATTAT
GCTTGATGTTTTTATGTGTAAAGTAACGTTTAAAATAAATGACATTTGTACGCGGTTTGA
CCCTAGAGGCGGATTTTAAGAGCCCTATAAGACCCTTTGGTCTACATCCTCGATGCAACA
ACCTGGTTGAGCAAAGATGTCATCAGAGGAGGAGAAACGGTGAGTTTTGGAAGCGGCCTT
CCTCTGCGTGAGGCACAGCCACCAGCCGTAGTAGTTCGCCTACTTGGCCACTAGGCGGCG
GTACCGGAAGTTACCGTCTGCTAACGCCCCGTTAATGAGCGCGAGAGAAGAAGAAGGGCT
CCGCGCCAGCACGAGGAGGTGAGTAACCCATTTTATCCACTTTAATCCACGTTTATCTTT
ATAATTACAACTCTTTTGACGTTACCACACCATAAAGCATTTGTATGATCTTTTGGTCGA
ACAATTTTCGTTTATAAAAGTCAGCTTTCTAGAAATAAAAGTACTTTATTTTTCCGTTGA
GCACACCTTGTGTCCATAGTTCGATTATAATGTACTTTTTTGTGTTTGCATAGACAGAAT
GTGTGTGAAAGCGCCATGAAACAGTGGAATGGAGACAGAAATCAGCCTTTTCTATGAGTA
CATCCAGGTCTATCCTGAAGAACAGCACATTAAAGGCCATTTGGTCACTTTGCTCTGCAG
ATCTGAGGTCAGATCTGTGCTCTGGACTAGTTTAACTAGTTTAGGAGCACAGAGATCTAA
CCTTGGATCACTGCGATGAGTGCGAATCTACAGGCATTCCTGTGCAGGCTTTTGCAGCGA
GGCCCAGCCTGATGTGGCTGCGTCCTCCCCTCCCAGCTCTGCCAGAGTCAAGCGGGGCCG
TTTGAGGCTCTGCTGTGGTTCTCCACACCAGGGTTATAGGTTCGCCTCCAACACCACCTC
TAACCTCAGGCCTGACCTGTGTCCACTGTACACGTGTGGTGTCCTGGCCGGATGTTCTGA
AGCCACGTCTGTTTGCAGGCCTGCAGAGATGGTGGAACCAGGCTGACCTGAGGGTCCGTG
TCCATCACATCGGAACGAGCTGTCCAGGGTTGTGCAGCGGCGCCGGGTGTTTGCGTGGGT
CAAAAGTGAACGAGATGGACGAGTGCAGACGTTTCCAGCGAGGCCCAGCCTGATGTGGCT
GCGTCCTTCTGACGTCTGCCAGAGTCAAGCGGGGCTGTTTGAGGCTCTGCTGTGGCTCTC
CACGCCGGGGTTATAGGTTCGCCTCCAACAGTTTGATCTCAACCTGAGCTTGTTTCAGCC
TGTTGTTGCCAACTGGTAATAGAGTATTCCACCTCCTCGGTGCTAGTGTACCTTCTGAAA
GCCGGTGTTGATCATATTACCTTTGATGCTGTAGAATTTTGATCTGAAAACGTTACTTTT
CCAGGTTTTTCCACCCTGAGTGACACCTTTTGCCTGTAATCACACGGGTTGGTGACCAGG
CCCGACTACAGGGGAACACGCAGGATTTAAGCCAGAATACTCAGTGGGCTATAGGAGAAT
ACTTAAAGATTGTCCCACAGTGGGGAAATTGGCAGATGATTGCCTAAACATGGCAGTGGG
TGGTACAAATTAAACCACAGTTCTGTTCAATTGCTTTATATTAAGAAATAAAATTATCCA
AACACGTTTTTTTCTCTCTTTATAAATAAGACCAGATTGTTACTGACTTATAGCTTTAAT
TTTGATGTTGCCTACATTGAGCATAAAACTGTCATCTTTACTAATAACATGGGTGATTAA
AAACACAATATTAAGAGGACCGAAGCCAGTTGGTTTTAAAATATGTCATGAGAATATTGG
TAATAACAGTAGGGAACCCTTAGGAGTAAACTTCATGGGTAGAGCAGAATCTCCTACTGT
GGACAGCAAAATACACCGAACCTTGTGACTAAATAAGCACTGTAAATGCTCTATTTTTAA
AACAATTTATTACATTGTGGGGGATGAAATTTACCTAATATACAAATGAAAACTGTAATG
TAACGTGAGGCATGTGCTGGTTTTAATTTGAAAGGTTCAAACAGGCGCGGGTATGACGTC
ACTTTGGTTTCGTTTTTGATACAACTGAAAACTTGTAATGCTGGCGCGTTTAGTCCGCTT
TCTAAAGGGGGAACTGTCGTGATTTAAGGGTTCCTCTCCCGCGGAGCTGCGGGTCCGGCC
CCGGCGCACATGGACGGACGCACGGTGGAGGTCCGGGGGGTCCCGGACCTTCTTCCAGAC
GAGCGCACAGTCGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved