Tetraodon_nigroviridis Locus rps27.1
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rps27.1
Tetraodon_nigroviridis
rps27.1
21_random
SNORA35
2309..2438
3925
AAAACACTTGATTTTGGCATGAATTTACATGTCTTTTCAGTCTAAAACTGCATATTTTT
TATTTTATGAATATTTTTGAGATTTGTCTGTAAAAACAGACGAGTGAAGACATTTTAACA
GGAACCAAGCCATATCCTCCAAATGGATATTTGTTGTCTAACCTTTTTAATTTTCCTTGA
TCGTATTTAGCTGTACTTTTAACTTCCATGACTTCAAACTAAGTTAATCGTGACGCAGTT
CAAGATGCTTGTAGCTTTTACCAAATGTTAATGATATCAGTGATGCAACACTATCTTTGC
CACCTGTTATGTAAAGAGTTTGTTATGGTAATTTATTACGTTTTTAGAAATTTGAAGACC
AACTTTCCAGGCCTTGGCAATTCATTGGATATCAAATATTTCCCAGCTGTTTGCATCAAG
GCTCCTTCCAGTGCCAATACATCAGGTAAAAAGTGGAAAGTTTAGTGTGCAGTGTCCTAA
ACATGAGTGCACAACATGAAATAAAATAAATAAACCTTTTTTTCTATAAGGTATCAGTAT
AAAGGTAAGTCTCTGACCAAAACTGTATCATTCAGAATACTTGTTCTTCAGGATTAGTAA
CATCACAGTGCCTGTTAAAATATAAATGTAAATTGGAAAGCATAAATTTGCTATTTAAGG
TCAAGTGTGCGTATCAAAGCAGCACATTTTAAGAAATAAGATACTGTGAAAAAGAAAGAT
TTTTAAAATAATTTCTAATTCTGATTCTACAGAAGCAGCAAAAGATTAAAACTGGTTTAG
GACACGGTTCTCAATATTTTGAACAATTATATGCATTATGTATGACACATTGGAAGATTT
ATTAGAACACGAGATAAAACTACTTACTTCTATCTTTTATAAACCTTTAATAAAAATATC
CCGTTAGAAATTGCGTGTGACGTCATCGTCGCGTCGCTGTCGTCATCTCCGGTCCGGGCC
GAACGGCGCCACCAATATCAGCTCTCTGCTTCCGGTGATGCCTCCTTTTCGGCAACGGCT
CTTTTCTCGCCAACATGCCAGTGAGTATTCCCTTCAGTTGGAAAGAGACATTTCTACCGT
TTAAACCGCACGCTGAGGACCCAGACACAAGCCATCGTGTGTTTAAGAAGTTGGCGATTC
AACTGATATAGGTTTAACACGGTTTCGTTCAGTTTTTGGACTAGTTTTGAAGAATTAATT
GCAGCGCATTCAAGCGCATTGTGACACAAGATGGCTGCGCACACAACGCGAACATGGAGC
CAAGTGAAGAAGCACACGGGCGTGCTAAAGGCTCGAAATTTTCAACAATATTCTCGTTTG
GTTTAAATCTGCTGTCGGTGCATTGCCTTAGTCGTTTATTGTACTCGATGTGCAAATCTT
CTTGTGCTAAATGTACAGAAATATTGTAACAGGATGCTAGGTCCAAATACGTAGCTAGCT
TGTGGTCCAAGTTAAGTAACGCAGGCCGATGGAGAAGCGACAATGCGTCAAGGCTCCGTT
AAGTAGAATAAAATTATACAAGAAATCTTGGGCAACGGCGGGTTTTATTATCGTGTCAAA
TAATTTATACTCATCATTGCGTGAAACGAGTCTCTTTTTTTTAAGATTTGATTTTTGACA
TGTGTTCCACTGATGTTGCTAACGTGATATCTTTGTTCCTGTCTCATTAAAAAAAAATTA
TAGCTCGCAAAAGACTTGTTGCACCCATCCCCTGAGGAGGAGAAGAGGAGGCACAAGAAG
AAGCGTCTTGTTCAGAGTCCTAACTCTTATTTTATGGATGTGAAATGTCCAGGTATGGTG
TTCTTGACACGGGGTCTGCACCCTTTCCATTCACCCGCCTTGATTGAAAGGCAGATGTCA
GTGTTATAGCTGCTTTTTTTGTCCATTTTTCAGGCTGCTACAAGATCACAACAGTGTTCA
GCCATGCTCAGACAGTTGTGCTGTGTGTTGGTTGTTCAACGGTCCTGTGTCAGCCCACTG
GAGGCAAAGCACGTCTCACAGAGGGTCAGTATTTCCATACAAAATCTTTTTTATAAAACA
ATTGAATGCCCATATTTTTCCTCATAAAGGATTGTTTAAATATGTGCTCAATGTAGGTTT
TTTTTCCACCTGAAAAATCCTTCAAACTGGGGATGTATTGGTAATATTATTACACATTGC
ATTTAAATGGTAATTTCCTCTAACATACAGCCCCAGTAATAATACAACATAAATGGTGCA
AAAACTGTATAGTTTTGCAGCTTTTATGTTTACAAAGTAATACAGGAGAGATTTTTTTTC
CCTTAGATTGCCATTTTTTGAATTTTGCGGTGCACTGTCAAGTGACTGGATTTCCTTTAT
CGTGGTCTTCCAATCTCATTCCAGTGCCAGAGCAACCTCAGTTTGCAGAAGGGTTGAGCT
AAACGATTGGCCCCCCCCTTTCGAAGGCTGAGAACAAAAATCTCCTGTTATTACTGCGCG
GCGTGGCAGTGGGGTTGGGTTTGGACCGCTGTGCTACATCAGTGGCACATCCTGCCACAG
CCGGTGTGGAGTCACTGGTAGTGGAAACGTGGCTAGTCATGCATTTGGGAAAACAGCTCT
TGTATCAGCACTGTGGGACAATGGCGTGCATAGCTGGCTGGATTTTTCCACCGTGGCGCT
TGTTTTTTGTCTTAGTCTGACCGTTATTGTCTCTTATGGCAGGGTGCTCATTCAGGAGGA
AGCAGCATTAGCTGTCCTCCCTGGATGTGGGCGAGAGGAGGGAGCGGACCGGTTGATATC
AGCAGTGTTTGCTTCTGGAACAGGAGGCAGACCCAGTGGTCTGACCAGATGAGACCTGAA
GATGGGCTGAACCGACGGATGTCCACTCTCGTGTGGACTGGTGATTGCTGTAACTCCACC
CTCCAACCCCGTCTCTCTTAATAAAATGTTGTTTTGGCTAAACAAATGCTTTGACTTCAT
TTTTTTTTTTGTCTTAGGAAACCAACTTTGTGGACAGCAGACATTTAATAGACAGTAGTT
TTATTACAAAGTACATGGATTCACAGCATGGCAAGATCACATTTGTGCAGTATTTGTTTT
TATTCTACAAAATCAGAAGGGTTTCACCACAGAACTAACGGACCTAGTATGTTAGAGGTA
AGTGCGCGGGCAGTCGTTGCTAATATTGGTAAAGGAAAACGCCCATGACAGCCCGGGACC
CTCCTGTGTGTACCCCACACACTCCTGCCTGATCCTCTCCATAAACGGCTTGAAGCGGCG
TCTCCGGGCAGCAGTCTGGCTCTACTAATCCTCCAGTGCCTTGTCCCGCTGTGCTTCTGT
TTTTCCCTCCCTCTCTCTGAGCAGGTGGCGGATGGAGGAGTTCTGGGTGGAGAGCGTGCT
GGAGAGGAGCGGCAGGAGGCTCCTGAAGCCCTCCCTCAGCTCCTCCACCTTCTTCTCCAG
GGTGTCGATGTGGGAGTCCAGCTCGCCCCGACAGTCCTGCACCTCGGATAGCACATCATA
CACCAGGCTCTGCATCTGCCAGGAAGGTGCGGGTAAAACACACCTTAGATGCAACGTTGT
CACGGGTTCACGCGCTTCCGCTGCTCGTGATGCGTTCACTTGCCTCTCTCACCTTGCCGA
GATCCACAAGTGAGTTGCTCTGGTCTGCAAATGTCCTTTTCTCCATCTTCATACGCCGCA
GCCTGGGGATACGCGTTTTTATTTTCACAACAAGACTGTGTTCTGTCTCCTGGGAGAAAA
ATTATTCAAAAGCTGCCTTCATTTGAAAGAGTTAAGAAAGTGTCCGTTCGGGGCGGAAGG
TTATGGCGGTCACCCACTAGGGGGCAGCATCGGCCAGTTCTTTTTAAAAATAGAGTTTTT
AGCTTTTAACTCAATGTTGCAATTAATTAACTACTAATTAACTAATTAATTTCGTTTTTG
TTAATTAATTAACAAAAACTAAATAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1683..1791, 1893..2003, 2682..2697, 2740..2925
1034..1039, 1683..1791, 1893..2003, 2682..2697, 2740..2755
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved