Tetraodon_nigroviridis Locus pabpc1b
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis pabpc1b
Tetraodon_nigroviridis
pabpc1b
21
SNORA5, SNORA5
1992..2125, 4093..4227
6936
GTTCCGACCTCTGACATAGATCCGTTGATCTGTGATTTTTGGAAGCACCAGGGATCCTC
TAGAATCTGAAACATCACTAAAATCTAATCACCTGATCCATCCATCTTCCGCTCATCTGG
AGGAAGATGGATCGATGGCTCGTCTGGTCCTCCACCCATTATCAGGTTATCAGTTATTTT
GGAACGGTGGCTGCTACCTAACCTCCGGCAAAAGTAATAGGCGCCAATCTAATGTTTAAC
ATTGTCAAACCAAAGGTTTTATTGGCGATCAAAGAAATCTGTGGTAAAACAGACTGATCT
GATAGCAGCATCCGCCTGATAACTGATGCTGAATACTGGCGGTCCAGCAGGAAAGATCAA
GAGCGGATAAAACAACGTTCATTCAATTTGTCACTTGCTGACTATTATAATAGTAACCTA
TGTGGGTACAATAAATAAAACTCTAGTATCCGATCTGTCCATACTTAATGGTGAAGTCCG
TTTGACATTTTTTTTAACTTTCCTGAAATTTGATTGGCTCCTTGTTGTGACGTAGCGCCC
ATTACTTAAAGACCACTTCCTGGTTGGTCTTCCCCCTCTACTCTAGCTGTTAGTGTGAGC
GTGTGTGCTCCTGAGCTCGCTCGGCACACATTCTATAAAAATATAAAAAAAATACAAAAA
AAAAGTTAAAATATAAAAAACCAAAAATTATCACTTTTTTGTAACGAGCTGGCGAAGCTG
CAGTAGTCACCGGACCGGTAAGAAAGGACTGCTAAACCTCAAGTGGAATCGGATTCTAAA
GCGAGGCCAAGTATTGCTAATTTTGCCGACACCGTTGCGTACGAGACCATTTTAATTGCG
AAATAAGTTCGTCTGTTGAGTTGTTTTAAAGACCATTTTACGCGGTAACGGTGAAGCTTA
GAAGGGACCGAATTGACGTGACGCTAGTAGCCAAAAATTCACCTTCGCCGGAAAGTTTGA
TTTCACCGGGAGTCTTTGGCTAGCTTCCTCGAAAGACCAACATGAACCCCAGTGCTGCCA
GTTACCCCATGGCCTCCCTTTACGTCGGCGATCTCCATCCAGATGTGACAGAGGCCATGC
TGTACGAGAAATTCAGCCCGGCCGGGGCGATCCTGTCTATCCGGGTCTGTCGGGACATGA
TCACCCGCCGATCCCTCGGATACGCCTATGTCAACTTCCAGCAACCAGCCGACGGTAGGT
CACGCAACCGCATGTCCATCAAACGCGCTAAGGTGTTGGGTAGACACGGTGAAAAAGGGG
ATAGAGTTTTACACGTGACTGCGACCGACATGTTGTAAAGTCTCCTCGCTTCACCCTCCC
GGCAGTGGCGGAGCGGAAAGGTGCCCCGTCCCGCCCCCCTCCCCCCGGCGGTAGCATTAG
CCTGCTAGCTAGCTAGTAATCCATTCTCATGTTTTCTGTTCTCTGAACACCACTTTTAGC
AATAAAGCCGCGTACTCTAATTGTGTACGATCAGTGATTGCTTTTCGGTCTTGTCACATG
AGTCATTTCATGTATCTACAGTTATTTCCAACTTTAAAAATGCATTATCAGTGTTGCGTC
TACCCACAGTTCTGTGTTTGGTATTCTGTGTGTGGTAGATAAGAGCGCAGGTCAGCCTCC
ATATGACCTTCTCGGCTGTGTTTTCCTGATATCCCTCCACTTTTTAAAAAAATGATAACG
TACTTTTCAATTTTACAATCCAAACAAAGCAAAATGAGAGTGGTCTGTGTCAATAAAAAG
AGCACCAGTGGGCAGCATCTGTTGTTGAGATGGTAATTTAAGTTTATTCCTGTTTCTTAT
AAAAAGTTACCACCTAAAACTATTCAATGAGGGGATGAAAGTGAAGACATAATGCAGCTC
TTTTATATAAATAAGGTTTAATCAAATTTGAAGACATATGAGTACGTGTATCCACTACCA
TTCCAGACAGTACTGACTATTTTCAGCCTATGACCTGGGAAAAATGTTTCAGCACTTTGT
TGTGTTAGGATTTGCAGCTTTGTCAAATTCAGTGCTCTCTTTCACTAGGTTGCACTGGCC
AAAATAGCTGCCACAGTAAGTGTAATTCATGGGCCTCTCAGTTCTTCATAATGGATTGTG
AGGATAAACATGTATTACTGACAAATGTTGAACACGCTAACGTGAAACGGCCTCGTCGTG
CGTTCTGCTAGCACTGTGTGAAATTCCGGATATCTTTGGTGACCTCTCTTGTGATCTGCC
CCCCTCCAGCTGAGCGTGCACTGGACACCATGAACTTTGATGTGATCAAGGGAAGACCCG
TGCGAATCATGTGGTCGCAGCGTGATCCATCATTGAGGAAGAGCGGCGTAGGAAACATCT
TCATCAAAAACCTTGACAAGTCCATTGACAACAAGGCTCTGTATGACACGTTCTCTGCTT
TTGGAAACATCCTCTCCTGCAAGGTATTACATTTGAAACCATAGTAGTGTTGTGAATGAC
GGACTGCTTTTTAATGAAGAAGGTTTTTTTTCTCTATTTTATCACCTACAAATCCAAGCA
TGTCTTTGACCTAGGGTGGTTTTTTACTCTGCATGTCCTCTTCTGTACCGGACACGCTGC
AGTTTTGATGCTTTTCCTTAAAAGTAAACGTCAGCATCTTAACTGCTGCTGGTTGATGTA
ACTTCCTCCCCACTCTCGTCTGTACAGTCAGACCCCTGTTTCTCCCTCTTTTGGATCCAG
ACGGGTGAGATCCGTTGCTGAATAAGCAGCGTCAGCCCTTTGCTTTGAGTGTGGGTCCAC
TTTGCATATGTGTGTTATGTAAATGCCCCAGAGTTGTTGAAACTCCTGGAAGGAGCAGCC
GCCCTGCAGGGATCTGTGAACCAATCGCGAGCATTAAACATTCAGCGCTTTGGTTCCGCG
TTGGTGTTCGTTGTACCCTGAGACCAAGTAATTTAGTCTTACTGACATTCCTACTACAGC
CTATCAATAGGTTTGCTCATTGGATTGAACTGTGGTATTGCATGTGTGTGTTAAAAGGTA
GCACGTGTCTTCTCTCTCCTAAGGTGGTTTGTGATGAGAATGGCTCTAAAGGCTACGGCT
TTGTGCATTTTGAGACTCAGGAAGCAGCCGAACGAGCCATTGAAAAAATGAATGGCATGT
TGCTCAATGACCGAAAAGTGTGAGTGTTTCAATCAGTCATAAAATGTCTTCCGAATGCTC
TGTGATGCTAATGCAACTGTGTGTAACATTAACCTCCTGTGGTAGCTTGATGCTCTGTTA
ACCTTAAAGCCATATATGTGCAATTGATCACCTGGTAAAGTAAATAACGACCCTTGTGTT
TTAAAATATTCTCCTCAATGCAGATTTGTTGGACGCTTCAAATCCCGCAAGGAGCGCGAG
GCCGAACTCGGGGCCCGCGCCAGGGAGTTTACCAACGTTTACATTAAAAACTTTGGTGAC
GACATGGACGAAGAGAAACTGAGGGATGTTTTTAACAAATATGGTAAGTTGGTGTGTACG
TCAGAACGCTTGTTCGGTAGAAAAACATCCCATGCTCAGAGTGGAATCTTTGCCTAGGAA
ATGCCATGAGTATCCGGGTCATGACCGATGACAGCGGGAAGTCCCGGGGCTTTGGGTTTG
TCAGCTTTGAGAGACACGAGGACGCCCAGAAGGTACGAGTAGCCGTTTTTCTAAGACGTG
GGTGGATCAACCCAGTCCTACCGGGCCTATAATCCAGCCAGGTTTTCTGTCCAACCAGGC
AGATAATGGCTTTCTCAAGGAAAACTGGATCCAGGTGAAAACCTGTCTAACTGGTAGGAC
GGAAAACCTGGCTGGATTATGGGCCATCTAGGACTGGGTTGATGACCGCTGTTTAGGAAA
CATCCACCACTTCTTTTTTTTTTTAATGCCAATACTTACTTTTCTTGTTTGCTGCAGGCT
GTGGATGAGATGAATGGGAAAGAGATGAATGGGAAACCCATTTACGTCGGCCGCGCCCAG
AAGAAAGTGGAGCGACAGGCGGAGCTCAAGCGCAAGTTTGAGCAAATGAAACAGGACCGC
ATGACTCGCTACCAGGTCAGTTGCTAACGAAGCTGTGGCGGTCACCCTGTCTGGTGAGAC
GCATTACCCCCTCTGCAGCTTTGTCAAATTCAATGCTGCCTCCTCGGTAGGTGGCATTGG
CCAAAATGGCTGCAACAGCAACTGTAGTTCATGGGCCCCACAACTCTTCCTCATGAGTTC
TGGGGATAAATATGTGCTACCGACAATAACACTGATGAAAGGTGTCGCTGACGTCATACT
GGTCGCATTTTGAAACGATAGGTGTCAATAAAAACGTTGTGTTTTCAGGGTGTCAACCTG
TATGTGAAGAATCTTGACGATGGAATCGACGACGAACGTTTACGAAAGGAGTTCTCGCCT
TTTGGCACCATCACCAGTGCCAAGGTAGGACTGGTGCTCATTAATCTATGAATGAACCAA
CCTCATGCTGAAGTTGTGCCTGTGTTGGAATCCTTTACGTATTCCGCTCGGCCACCCCCA
GGTCATGCTGGAAGGCGGTCGCAGCAAAGGCTTCGGCTTCGTCTGCTTCTCCTCCCCGGA
GGAGGCCACCAAAGCCGTGACCGAGATGAACGGACGCATCGTGGCCACCAAGCCGCTGTA
CGTCGCTCTGGCCCAGCGCAAAGAGGAGCGCCAAGCACACCTGACCAACCAGTACATGCA
GCGGATGGCCAGCGTGCGCGCAGTGCCCAACCCCGTCATCAACCCCTACCAGCCGGCCCC
GCCCTCTGGCTACTTCATGACCGCCATCCCCCAGACCCAGAACCGGGGCGCTTACTACCC
GGCAGCTGGGCAGATGGCTCAGCTGCGCCCGAGCCCCCGCTGGCCCACCCAGGGTGTCCG
GCCGCAACGTGAGTAAACGCAATACTTGTTAAAAAAAGACACAATCCTGGAATTCAAATG
TCCGACTGCAAGCTGCTTTACATCTGTGGCCTCAGACTTCCAAAACATGCAAAGTGCCAT
GCGCTCCTCGGCTCCACGCCCTCAGATGTTCGGCTCCATGCGGCCTTCCTCGCAGCTGCC
TCGCATGACATCCAGCCAGCGTGTTGGTAAGTCGCTTACCGGCTGTTCCCACCATTCAAC
CCTGCTTCCACGTGTTCAAATAAACACGCCATCTCTTGCCACGACTCTTTTTTTTGTGAT
TTCTCAGCCACCCAAGCCATGGGTCCCCGAGCAGCCACCACGGCTCCTTCGGTAACAGCC
AATCCTGTTCGGGGGGTCTCCCAGTACAAGTACGCCACAGGAGTACGGAACACGCAGCAG
CACGTCAACGCGCAGCCGCAGGTCACCGTGCAGCAGGTAGGCCCGTGACCTTTTAGGAGT
GAGATGGTGCCTGTGGTGGTCTAAACGAGCAGCTCCTGCTCCTGCTCCTGCTCCGCTCCG
CAGCCCGCTGTTGTCGTTCAGGGACAGGAGCCGCTGACCACCTCCATGTTGGCCGCTGCG
CCGCTGCACGAACAGAAGCAGATGCTGGGTGAGCGCCTTCCCATCACGCATCCGTCCAAA
TCTTTGCTCCCGTGCTGGTGTTGAAGCCTTCGTCTGGTGGGTTTTTCCCTGCACAGGCGA
GCGCCTCTTCCCCCTCATCCAGGCCATGCACCTGAGCCTTGCGGGAAAGATTACCGGCAT
GCTGCTGGAGATCGACAACTCGGAGCTTCTCCACATGCTGGAGTCGCCTGAGTCGCTGCG
CTCAAAGGTGATTGAAACCTAATTCATGCTAACCTGCTGCTAATGGTTAGCGGATGTGTG
TTCCTTCATGTCTGGATGTGTGAGGCTTCTGCCTGGAAGCGCCGGATCAGCGTTTTCATT
CGGATTGGATGGATCTGATTCCAGGTGGACGAGGCGGTGGCCGTGCTTCAGGCCCACCAG
GCCAAGGAGGCCGCCCAGAAGTCTGTGACTAACTCAGCCGTCGTGCCAAGCGTGTGAATC
CGAGGTAAATGAAGGTAAATCCAAGATGGCCGTTCTGTCGTCTGACTGTAGGTTTCAGCT
CCGCAGAGCCGGTGGAAACCAGTTGAGACGAACGATGACCAGGGGGAAACAAAGAAAAGA
AATATATCTTTAGAAAAAATACTGGAACCAAGTCTTCGGTCGGGTCTAGGAAGAAGTGAA
ACTCCAGGCCTGGTTTGCAGAGTTAAAAGAAAAAGCACCAAAAAAAAAGCGAAAAAGAGA
AAATCTAAAATGATCATTTTGAGGGGTTTTAGGGGAAACCTGACAGAATACGTTTGAAAG
CTTTCCTTTCTGCTGTTTTATCCCTTTTAAATGTTTGAATGTTTTGGCTGCAGAGGCCTG
TTATTGTGCCGTTTCCCTTTTGCTTGCTTGAATAAAACCAACAAAATGAGCCTTTGTCTG
TTTCCGACTGTTAACGGCTACGACTGAACATCACCAGACAGGAAGCAGCTCTTTAGAACA
TCGTTTATTTGAGTCAAGTACTTGTGCCGACACTGGGCAGAGGATGGAATGATGTCCCGA
TGGAAGGTCCAGCCGTGTTTGGTCCGTTTGGACCTATTTGCCGGTTTTGGTCTCCCCCAG
CTGCTTGATGAAGGTGGTGATCTGGTCCTGGAAGGACTGCACCATGGGCTGGATCTGAGC
CTGCACGTTGGTGGCCATGGGCTTGATCTGCTCCTCCAGGCTGGTGGTGAAGCTCTTCAG
CTGCTCCTGGAGCTGGGCGGCCACGGGCTCCAGCTGGCTCTGCAGGGTCCTGCGGGGGCA
AAGGTGAAAGGTCGTCGCCGGTTGGGTGGTGAGGAACGGTCCCGGGGAGGGTTGAGCTAA
CTCACTGGGCGTTGACAGAGCTCAAGATCTGGGTCTTGAGGGTATCGATGTACTGGCCGA
GCTTCTCCACCTCGGAAGCTTCCTGTCCGAAGCTTCCTGCAGGGTTAAAAAGAAAAAAAA
GGGGAAGAGCTTAATTAAAATGGCGTTTGTGACCTCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 2229..2422, 3023..3138, 3323..3462, 3537..3631, 3897..4034, 4308..4403, 4501..4867, 4955..5065, 5158..5315, 5403..5487, 5576..5706, 5844..5936
1001..1193, 2229..2422, 3023..3138, 3323..3462, 3537..3631, 3897..4034, 4308..4403, 4501..4867, 4955..5065, 5158..5315, 5403..5487, 5576..5706, 5844..5936
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved