Tetraodon_nigroviridis Locus eif3bb
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis eif3bb
Tetraodon_nigroviridis
eif3bb
18
SNORD60
4712..4799
6356
AGATCCAGAACAGAACATTCCTGCAGTGGGTGGAGGGGGAAAACGGGAAGATTATTACC
AAACCCTACAGCACAGCAAAGTTTGAACCACACAGTATTGCGTTTTACATCAGTTGTGAT
GTATGAGTGCAACCCACCTGGAGTAGTTTGAATCCATCCTCAGATGCAGCCAACAAACCC
GTAAGTTTGAGAGTAAAAGAGATAATAGCTGGATCCAAAGCTGTGTTGTTACCCACACTG
GATATGAAGGCAGGCAGACACGAACAGGTCTCCAGCAGACACGCACCTGCACCAGTACAA
AAGGAAAATAGGTTCATCATTTACCTCTAACTGGTTTTCTACATAGGAAGAGGAATAGTT
TCATCTGCTTAAAACAACTGGATGAAACTATTCCCCCGGGCCATTATGTTCTGTACTGAC
CAGACTTTGTAAGTCCTGTGAACCAGTCTAAGAGTTTCTCCAGACTGGTGTCATCGGGGA
GAGACCTCCTTGAATCCGCCAACACCTCACAAACTTGGGGTAGCAAGGACGCGCACTCAC
TGTCCATGGTACCTATATATCATATTATATACAGTATATTGTACTGTAGTGAAGTCGCTA
AAGCGTTACATTAGCGAACGCTTATGTCGCGGGAAATAGTTTCAGAACTACCGGTTTCTT
CTTCTTCTTTTAATAAAATAGCACTGCACCGTTTGTCATTTTACGGATCTTAAAGCATAT
GGATGTGTTAAATACCCAAGAAAAAGGTAGTCACGTAGACCAGTTTAAAGGCCATCCATA
TGTTTTACAGCTCTACTCTTTCCCTTTGATGTCCCACGAACAACTTCCGGTGCCGGTGTT
ACGCTTCCGTCAGGTCGTCCATTTTCACCATATCGCACATGCTGCCGCGCCGGTCGACAA
CCACTAACCTCCCGATCTTCTGGATTTTGCTTTTTCCCAGCGTGAAGCGCATCTTTTAGC
CACGATAAATGCAAGAAACGGTGGATATGGTGGATGACCCCGAGTATGAAGAGGAAGAGC
CCTCTTTCAGCGACCCCGAGGACTACGTGGACGACATTGAAGATGAGGGTGAGGGCTCGT
AGGAAAAACGCCGGCTTTTTGGCCTGTTGCTAACGGTTAGCTAAACTGAGGGTCGCGCTA
GCTGGTAGCGAGGGTATCGCCACCAAAAAGGTTCATCGTAAGATAAATAACTGCGTCTGT
GGACGCCGGACTTTAGGTATTTGAGTAGAATTTGGCAAAGATAAACGCTGATATCACGCT
CAGTATCATGGGACACAACCTTAGCGGGCGTTATCGTAGTTTTGTCGAAGTTCCTGCCAA
AGCTAACGCACTGCTGTAGCCTTGTCATTGTCATCTAAAGAATGAAATCGTCTAAATACC
CTCTTTTTTCGTTACTGCAATAGCACTGCAATTTATATGAACGGAATAATTACGCCCTTT
AAGTCTGGTTTGAATGAAGCAGCTGTTTATCAGCCAAGTATTGAAACATGTGCATCCCTG
CAGCCCTGAAATCCCCACCCTTCCGAAAATTATCCTCTACAACATTTAACCTCTACAAAC
TTGGACAGCGCTAATATGTGCTATTATTAAGGTGTTGGATGGATTAACTGTAATTTTATT
GTTGAACATGAGTGAAAGTGAGCAAAAAGAAAAGAGATCTTCGACTATTCGGCAAGACAA
TTTACCTGCATAAATTCAACCAATGATTTTTTTTTTTCCCATCTGTGATTAAAGCTGAAA
TTGTGTTTTTTGGTGGGGCTAATTGGTGGTTTTTTCTGTGGAGCTGTGGGTGAATATGAA
GGTTTTAACGTCACTTATCTTTTGTTTTCCCCCAGAATTTCTGGAAGACGTCCTGAGGGA
GAAGCCTCAGGAGGCTGATGGCATCGACTCTGTGGTGGTGGTGGATAACGTCCCACAGGT
TGGCCCTGAGAGGCTGGAAAAACTCAAAAACGTCATCCATAAGATCTTCTCCAAGTTTGG
AGTCATCACAACAGAATTCTACCCAGAGGCTGACGGTGCCACCAAAGGGTATGGGTTTCA
TTTTCCCCTGTGGTTTCAATTTCTGCGTTTATGATGTATTCATGCTTCAAACGTCCTCCG
CAGGTACATCTTTCTGGAGTACGCTGCCCCCACCCAGGCCCTTGAGGCTGTTAAAAATGC
AGATGGGTACAAACTTGACAAACAGCACACGTTCAGAGTCAACCTCTTCACTGATTTTGA
CAAGTACGTTTGTTGGTTTTAACAGCAAATACAGTCATTCTATTAGCAAATATGTGGAAA
AAATGATATTATATTCCCCCCCCCCCCCTCAGGTACATGAACATCAGTGATGAGTGGGAA
ACCCCAGAGAAGCAGCCTTTCAAAGACTTTGTAGGTTCATTTCTTACATTTTTCACTTGT
GTTCTTTTTCGGTGTAAATCATGGAGTTATGTTAACGTCATCGTGTCCGTCTGCTCAGGG
AAATCTGCGCCACTGGATTGAGGATCCAGACTGCCGTGACCAGTACAGTGTGATCTATGA
AGCCGGAGAAAGGACAGCAATTTTTAACAACGACTCCAAGGACGCGATCACGGTCGAAGA
AAGGGCCGTAAGTCAAATGCCGAGCTCAATTTTAATGGGTGTTTTTGAAAAAAATATGCC
GTTAAATGCAGCTGTGTGTCCGTGCAGCGCTGGACGGAGACGTACGTGCGCTGGTCTCCT
AAAGGCACCTACCTGGCCACCTTCCACCAGCGGGGTATTGCATTGTGGGGTGGTGAGAAG
TTCAAACAGATTCAGAGGTTCAGCCATCAGGGTGTCTCCCTCATCGACTTCTCACCATGC
GAGAGGTGAGCGGCGCCCACGCCTCTGCATGAGCGCTCCCACACACACGTCCTGTAATGT
GCGCGTTCTGACGTAATCCAGCGCTTGGGTTTACTCCGTGCTCGTCGTCAAGCCGTGCTG
CGTTTCAGGTATGTGGTGACCTTCAGTCCACTGATGGACACTAAGGAGGACCCACAGGCC
ATCATCATCTGGGACATCCTGACCGGACAGAAAAAGAGAGGCTTCCACTGCGAAACTCCG
CACATTGGCCCATTTTCAAGTCAGTAATTCCGGTTTCTCCCTCTCTCTGGGCGCCACCAT
AAACGAACAAAGACGGGATGTTTTTTTTTTTTTTTCTCAGGTGGAGTCATGATGGGAAGT
TCTTTGCCCGGATGTCCGCAGACACGCTGAGTATCTACGAGACTCCAGTGAGTTGAATCA
CTTTTTGAAACAAAAATCATTTTAAATTTACAAGTGGCATCACGCTAATGTCCTGTCTGT
TTCAGTCCATGGGACTGCTGGAGAAGAAGAGTCTTAAAATTAGTGGGATTAAGTGAGTGC
TGGTCATTGTTTTGTGTGCATATGGATACTTAAGGTTGCAGGGTTTTAAGGTTTCACCTG
GAATGTTTGTCTGCAGAGACTTTTCATGGTCGCCTGGTGACAACATCATAGCGTTCTGGG
TCCCTGAGGACAAGGACATCCCAGCCAGAGTGACTCTGATGCAGTTGCCTTCCCGCCAGG
AGATCCGTGTCCGCAACCTGTTCAACGTGGTCGACTGCAAACTGCACTGGCAGAGAAACG
GAGATTATCTGTGCGTGAAAGTGGACAGGACTCCGAAAGGAACGCAGGTACGGAAGCCGA
GTGGGAGCAAAGGAGGAAATGCAGGGTTTGGTTTTTAATAAATAAGAATCCTTGCTGATT
TTGAACCATTTCAGGGCGTCGTTACCAACTTTGAGATCTTCCGCATGAGAGAGAAGCAGG
TCCCCGTTGATGTGGTTGAGATGAAAGGTACGAGCGGAGGGAAGTAAAGTTGACCGAGGG
AAGAACATCAGCCAGATGTATCGCCCCTTCCTGTCTCTTCCAGAAAGCATTATAGCGTTT
GCCTGGGAGCCCAACGGCAGCAAGTTCGCCGTTCTCCACGGAGAGTCTCCAAGAATCAGC
GTCTCCTTTTACCACGTCAAAAACAACGGGAAGATCGACCTCTTGAGTGAGTAGCGGGAG
AACCAGACCCGGCCCTAACTGGTGTGGTGGCCCAGTTGCTGCGTAAGCTGCTATTTTATG
CTTTTCTTCCACTGATTCTGGCTTGGTCTCTTCCTGGGACAGAGATGTTTGACAAGCAGC
AGGCCAACAGCATATTCTGGAGCCCCCAGGGACAGTTCCTGGTGCTGGCTGGACTCAGGA
GGTCAGTTACGCGTGTGTTTGAGAGTTCACGATTCTGACTTGGAGCTGAGGCTCACGGTC
AGATATGTAAACGCATATTTGGGTGTGTTTGCAGCATGAATGGAGCTCTTGCCTTCGTGG
ACACGTCCGACTGCACCATGATGAACATAGCGGAGCACTACATGGCCTCTGATGTGGAGT
GGGACCCCACAGGTCGCTACGTGGTCACATCCGTCTCCTGGTGGAGCCACAAGGTAAAGC
TGCCCTGTGGCGGCGGGGATGTTGACACGGAGAAGATTGTTTTACCACCACGTCTTTCGT
CCTGCGCAGGTGGACAACGCCTACTGGCTGTGGACGTTCCAGGGCCGTCTCCTTCAGAAG
AACAACAAAGATCGCTTCTGTCAGCTGCTCTGGAGACCCAGACCTCCCTCCCTGCTCAGC
GCAGACCAAATCAAGGTAAACCAGGCCCACTTGGTGACTCTCACCAAGTATTACCCAGAG
TTTGGGGGGTGTGTGTGTGTGTGTGGTTGTGGAGCCCCTGATGACAGGTTAAACAACTTT
TCTGACACCTCGTATGAGAGCTGCCCTGCAGCTCCTGATTCCAAACCTGATCTGAGGCTC
AGAACATCCTGCAGACTAATGCCACCTCTGTAGATAAAATCATGACCGATGAACGTTCTT
TGACGGGGAATATTCCCTCTCGCCTCCCAGATGATCAAGAAAGATCTCAAGAAGTACTCA
AAGATTTTTGAGCAGAAGGATCGCCTGAGCCAGTCCAAGGCCTCCAAGGTTTGTTCGTTT
TTAGCAACTTCAGACTGTTTTAGCCTGCTACGGTTTTTCTTGGCTGCGTGTTACGATCTG
AGACGGGCTTTTGTTTGTGAGTAGGAGCTGGTGGACAAGCGCAGGGCCATGATGGAGGAT
TACCGCCGCTACCGGGATGAAGCAGTGAAGATCTACCAGGAACAGAAGAGCATCCGTCTG
GGGCTCAGAGGAGGTGGGACTGCTCATAACCGCCCGCACACACACACACACACACTTTCT
TTTTGTCGTGACACGTTGCTGACACCCTCATGCGTCCTCCAGGTGTGGATACCGATGAAC
TGGACAGTAATGTGGATGACTGGGAGGAGGAGACCATCGAGTTTTTTATCAACGAAGAAA
TCATTCCCTTTGGAGATCTCTAGTCCCCTACGCAGGTAACGTCCTAATAGAACTAATATA
AGAAACTGAAATGTTCTTTTCCAGAGGCTGACGTCGTCTCTTTCTTTTGCAGGCCATCCG
TTTTTGTGTGGAAGGAGGAGGGAGGAGCCTCGTCATTGTTCGGAGGACGAAAACGCGCCG
TGTATCTCGGGTTTCACACATCCAGCGTTCAACTTTGTCAGCCTTCACGCACGTGGATCA
GCAGCCACGTGCTTTTTTCTGCTTTTTTGTCTGTCAGCCAGCATCATCTACTCAGATTTT
CCCCTGTGGAACTTAATAATTAGCAAAACTGCCTTGTTTTTTATTACCATTCATCGGAGA
TTTTCACTCTGACCTCAGCACCGTCACTAACTGGACATTTGTCTGCTGCAGTTATTTTTT
TCATCAACATGTTCAGGTGTTCTCACAGGGCAACGCAGCTCATAACAGACTGGGGTGGAG
GTGCTCTGTCCAATCAACTAGCCTTCTTAAGTGTGCTGATGGGCCACTACAGTGGCCTGT
ATCCTCCTCCTTTCAGACTAGGCTTTCACACAGGGAGGGGGTGCGCAGTGGGAATAACTT
TAAATAAACATTCAAACACAAGAACTCCATTCCGGCTCGGTGTTTCTTTACATTTCAACT
CGGACCCGCACGTGAAATCGTCGAAAATATGAATCTTGTTCCCACTATTGCTCATATTTC
TGTCCTTTGCAGGTGGGCCTGAATGAAATTTCATCTTGTGTGTGTTTGCCAGCAGGGTGC
AGCTCCATTAGCCTGTGTGGCTGAATCCTAATGGAAGCATGAGGTTAGGCACTGCCTGTT
CTGTCCTGTCAGAATATTGATGCGCTAATCTGCACAGTTCTTTCACCTCATTAGTTAATC
ACTCTAATGGAGCGTGCGCTCTACACATGTTTACGCAAAAGGTGAACAGACTGTACCTGC
GTTAACAGGGTTTTTATAGTATACTGTGAGCCTATTTGGAAGAAAAAACAGGTATAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1835..2027, 2103..2222, 2312..2369, 2458..2586, 2667..2824, 2948..3078, 3160..3226, 3305..3351, 3436..3646, 3734..3806, 3883..4005, 4116..4200, 4294..4432, 4509..4634, 4890..4967, 5064..5172, 5262..5356
1001..1067, 1835..2027, 2103..2222, 2312..2369, 2458..2586, 2667..2824, 2948..3078, 3160..3226, 3305..3351, 3436..3646, 3734..3806, 3883..4005, 4116..4200, 4294..4432, 4509..4634, 4890..4967, 5064..5172, 5262..5356
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved