Tetraodon_nigroviridis Locus Poly:SNORD60
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD60
Tetraodon_nigroviridis
Poly:SNORD60
18
SNORD60, SNORD60, SNORD60
1001..1089, 1265..1355, 1514..1595
2597
tcatttaaaacagctgtgacgtggagtatacgtgccgttaaatgcgtcaccttctttca
ctgaataaaatgttactctgtgttggtcattgtccgttacgaatgactaaataaagttaa
aacactaaattataacttaccatatgcttttttcaaagttaagaggttaaaagcagaagc
gctgggttgctgcgaagctacgaacaggtgttgttgacgaaagccggttatgtaaacgtc
attgtggtaaaaacgctgacatttttttgtgaatagcgaggttagagaagactgttccta
cacttaattactgtttagagaacatgaattaattgaatctcataaactgtcctgcgcgta
cccgccacctcccgacggtagggggcagtaggcagcgttaccgcggccgttaacccgctt
tacggcaggaggaagaagtcgtccttcacgctgagcgagggtcgtggcagcagcagcgag
gcttctagctttgttcattcgatttctccaagtttttatcactcgacagccaaaatgacc
aagttgggcatttggtatcaagctgactggcgacaggagacgagttgtataggtaagttc
taatgtagttttggctttaagagggttaaaacaccacgttcctctgtggcaccacgtggt
tggatcacgaaaacgaccaaacgcgtttttgccaacttctaaaacaactccgattttttt
tcctattaaataagaattaaagttgctgtatttattcagtagacccgtcatctctgccca
attctgtggagtttcggggttttccagataaacgtgtcctttcgagaactggaatcgaat
tcactgttttcattttacaaaacaaacagtgatttgtgcagttattatttcacgattcct
tccaaacagatggattttggcaaatcagaagatatgggaacccctaaaagctgaaagcac
ccagatggtgagtttgtgttgccaagtttaaaaggtttaactcacctgtgatgacagaca
tgaattaaagcttttctgacacctactatgagagctttgcagctcctgattctgacttta
ctctgaggtttacaagttgctgttgtccgtcccgttgtcttttacctgaagtaaactttt
ctgtccacatctcctgcacagatgagaggatcagaccaagattgaagctctagagcagca
tcctccctggctttaaaaacccggtaaatctggtcaatctctgagctttttcccctttaa
agatgacgcctgtgatgacaagctaaattcaacttttctgacacctactatgagagctgt
gctgcagctcctgattctattcctcacactgaggctttttcagcagctataaacccacaa
atgcaatctggttcggttaattaaatctctatttttttccctttagaatcagtctgaaaa
gaagtgaaagcctgtgctgctgatgggcgttttaaaggtaaacgtgtgtgtgcacaggga
agtgtgtgtttgggcagccggtgatgttcagtggatattttctgacacctcgtatgagag
ccgcgtgctcctgattctagcttttaacctgaggccgaggagcaaatagctataaataaa
cgccttttctgccgccgagcttattttttgctgtttttctgtgcaggactccggaaagaa
gcttttctccagctgatggatcaaacctgaactaaagcacactttagaaaattagagcgg
cgttaacccccctgaactgtcagttttattagtaaattgaaaatgttatttttctaaaca
gtctctgttgtgtttattgactaacctatgttaaatgtacaataaatagatagttttata
gattttggactggactacggtgatcagcctatgcggtttcatctgttatctttaattttg
ttccgtggatcaggttttatactgcaacactgggtaagaagggatgaaacattaaacatt
gaaatggaatattttaccatgatttggaatgggaccagaaaagctccaaggccaacagag
ttggggtcgttgtggtcatggaaggggaggagtgagggacagtcctggcgtgtgtggcct
ccacgcgtccagctgtgagcgcgcaaacgtcatctccgctcatctgaatactaaaccgcc
tcccggcgtgttttccctccggagctcgtcctgatttgcgtgttttcctgcctgcacgca
cccggctgcgtgtccccggctcctcctttgactgccaaaccaggcggcggagcctctttt
ctccgccctgcgcatcatcccgcatccagtcgcttcccggagcgcggcagaggtgtgcag
cctcctcctcctcctcctcttcatcccggactcctccaccgactctcggctcttcccggc
cctgtctccaccctccattctccggcgctcctctccagaaggcccgacggtaagcgcggt
gcttgacgcggggaggctggtgcgtttttaccggcccgaagcggcctcatcctccaaaac
acagacgctcttagtttcattcactggcgctgaaatagaagtgtggctttcggaagaggc
cgtagggaatgatctgtg
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved