Tetraodon_nigroviridis Locus Mono:SNORA76
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORA76
Tetraodon_nigroviridis
Mono:SNORA76
17
SNORA76
1001..1138
2138
AAAAGCAGCCAAAGCAGAAAGTGTTGAACAAGCAGCTGGTCCAGATCACAGTCCTGATG
GGATGGAGGGCAGCTCTGTTCTGGAGACCCCTGATGCCTCACCTACGCGGCAGGAGACTG
TTGTGGAGGACAACTCGAAGAAGGGCCCCTTTGGGAGATCCTATCGTCACTGCGCGGTTT
CTCGCTCACCTTGTTCCAAACAAGTGCCCCGTGGCCGCTCTCAAAAAAGATCCCATCGGT
CTCCCAGCCCCGTTTCAAGCACTTCAGACTCGGATTCGCATTCCTCTAGATCTCGGTCCA
GATCCAGTTCACCCTCCAGGAAAAGGTGAGGATGCTGACAGCCTTGGACTATTTGCAATC
TGTTGTCCAGCCCTAAAGTTGTGTTTGTTTTCTCCTCAGATATCGTCGCCATCACTCCAA
CAGGAGCTCCAGCTCGTCGTCTCGTTGCAGCTCCGTGTCCCAGTCACCTCCCAGGAGGAG
GAGGCACTCGTACTCCTCCTCTCGTTCTGGCTCCTGGAGTCGCTCCAGGTCGCGTTCTGT
ATCTCCAGAGAGAAGAGCACAACAGAGCAGGAGATTGTACAGGTATATCACGAGGAGTCC
TGCTCGTTACTTGTCGTCATTTCATTTGACAAGAACTGTTTACTAAGTACACGGTATTTT
CCTCAGACCCTCATTTATTCCGGGCTTTCGTCAGAGTGCAAAGACAAATGTGGAAATGGT
GAAGAAATCCAAAGAGAGAGCAATTGTAAGCGAACTTGGTATCAAAGAAAGTTGGTTGTC
TTTTAAATGTCAGTGATCTGATTGGCTGTGGTGATCTTTTAGGAAGAGCGTCGGGTTGTC
TACGTTGGTCGAATAAGGGGAACAATGACCCAAAAGGAACTCGGAGAGCGCTTCTCCTTA
TTTGGAGAGATTGAAGACTGCACCCTGCACTTTAGGAATCACGGGTAAATACAGAATTGG
TTTGTTTTTATTTTTAAATTATGGATTCTCTCATCGACCCAGCACTGTCTTTGAACCTGA
CTGGTCCCATCAGTGACCTCTCAGGCCAAGCTACAGTGCTAAATGAAACTTGGACTTGTT
CATAACTGGGGCAACCTGGCAACAATCCCAAGTTGCTCTTTTAAAAGCAAGTCATAGCTC
GTTACAATAAAACATGACCCTCGGTTTTCTTCGGACCCATGACAATCGGTATAAATAGTG
TGTGTTTCCCCATTCCTCTGTCACAGGGATAACTATGGGTTTGTGACGTATTACGACACC
AAGGATGCTTTTGCTGCTATTGAGAATGGAAGCAAGTTACGCAAACCTGATGAGCTGCCA
TTTGATCTCTGTTTTGGTGGAAGAAGACAGTTCTGCCAAACCAGCTATGCTGACCTCGGT
ACGCTAAAGAGTTGCAACACCGGCAGCACGACAAACAGTAAAATGAGATTATGTTTCAGG
AAGAAATCTAGAATTAAACTACAAAATGACATCCAGGAACATTAAAATAACAGTATACCA
ACTGTAAATAGGGCCATTGTGTTTTCATTGGCTTGGAAGGGATCATTGCAACATTGATTT
TTGATTGTAAAGGTTTCCATGACTCGACCTGTTCACTGACCCGTTCAGTTAAACACAAAC
ATGCCATAGTTGCAATTCAAAAGACCTTTGTTAAGCAAGTTAAGCAAGAAGTAATACTCC
AAAATGGTCAAACTACTGTGTGAACCATTTTTTGCTGGTTTTTTGAGCAAAGCTATGGTT
ACTTGTGTATTTGAAATGGTTTTACCACGTTTTACTGCCCTCGTAATTTAAACAAGCGTT
CATTTTGCGTTTCTTTTCTCTCCTTAGATTCAAGTACAGAGTACGAACCATTCCCTGCAA
AGGGCAAGTTTCATGCACTAGACTTTGACACTTTACTGAAGCAGGCCCAGCAGAATCTGA
AGAGGTAACGGGAGGCCTGCAGCAGAAAGCAGCTGACACTTACCTCAGAGCCAGGCATGG
CTCCCGACTGCAACACTGTCTTCAACTTTTAGTTGTTGCATTACTTGAGTTTGTTTTTCC
CTTTGTTGTTTCTGCAAGATAACACCTTCTATTGAAGTGAAGATTTGTAATGAAAGTAAA
AGAAAAAAAAAATGGAATAAGTAAAATAAATAATTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved