Tetraodon_nigroviridis Locus Poly:snoU2_19
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:snoU2_19
Tetraodon_nigroviridis
Poly:snoU2_19
16
snoU2_19, snoU2-30
1001..1054, 1140..1223
2223
aggacattggccaaattcgtcgcaaactattcgcatcccttttgaaagttgtagcagaa
acaaataaagaagctttatcgcaatcagaagatgctcaggaggaagacgagactacgttt
aatagtggtaagtgggaattttctgtttgaaaatcatttaaattccagtcacagcattta
aaagcagtgtatggaataccaccgaattcttttctattttccagaagaagccgtctctga
gaacgtgtttgctggacctcccccagcatccgtccatccagaagccctttggtttcctgc
tcaggccacaaggcctccagtgacccgtgtcaagttagctgtgtgggagatgagtgagca
gcacgagctcagtgttattcctgaagtggagacacctgtgaataccagcctggtcccagg
tcagctccacgctgcaccacagcatcactgggccaactctgaaccttgttggcgtcagag
gaatatcaggtgacgacgtgttcattcacaggcttggagaacagtctgaggcttccttca
cgcggcgttgaccaggatccactggaagaatccgactgggccagactgaaatcctgtggg
cagcagattttcgaacagtcgatgatctctgagacaagttcagggacctctggccatctt
gtgtggacaaagaggcttctgagctcgtcagaatcctctccacaagttgccggtatgagg
atgtgaggagcatacatattttgatgtgtgggaaacgaaggtgcgtttatttagtggatt
tgtttttcctccgctctccagtttcaacgatgacctctccactgtcctctgactctggga
gaggagctgactactctgggccagcagccacaaccttgacgtctcctccagaggtaacca
agctcagtaaatctgcacaataaaagaacccgattagcggagtcgttacattttactggt
cagcccggaatgacgcttccctctgaggttcacatatcgtggatcaatgatgaaaaatag
ccaaatctgagttcttgggctcagttgtcctctgactttgattatgcttgagaagctttt
tatttgtgcgtgtacgtgtgtgtgtgtacgtgcgtgtgtgtgtgtgtgtgtgtgtgtact
gagcaatgatgtgaaattacatgtccagaagtgcgttttattaaaatgcatttcatgatg
gtttctacacttgaactgagctcagtgtgtctgcatggatattttctataataaagatct
acattcattgagattgcaaatgttctgaatttatattctccagtatctaagaggtgcttt
taagagtttaaggctttagcagaactgtaaaaagtctcaggtcaaagcagttcttgctgc
cgttttcagtcagtcgtctaattgttggtccttgtgtgtgtgtgtgttggacaggctgcc
ctcggtgctgccggtcctgaatctgactgcctgtccaccatctccactggcagctacgtc
accaccgacccggagcaacacccaggtaggcaggcccggctgtgaccgctcacgcctgtg
cttttgtccgaggtggttcactttgtgctgcttgacgctgcttcccctacttagataaat
cgcccaccctcgttcgtgtgggacaaggagcagagttacttgcagtcttctccccaccca
gtggaagcatctgtatccaggacagcgcagctgcaggctctccacatctggctgtagaga
ggctgtttagcgacagcggcatccaacgcataatagacaaatacacaaaggagctaaact
tctccctctgctctcctgggagaccaacaggtaaacatgtggatggtttactgaagggat
tcttagatgtgcagcccacaaccagggccggaaaggtaattgatggtctactttcgcgtg
ttcttattcagagggtgaaggtttagccacgcaggctcctggagcttcagctgccgatcc
atcagcgctcctgaacgaggagacgaacgagaggactggaagttctcctgggagggagtc
tggcccctcagacagcgcagcagcacaggaaaactctctggttggtgccaagaatcagaa
tgtggattatttttgctcacactagcacttgttttaggaaagaatgggcctaagttttac
ggttgtattttcaaacagcagtgggcgagcgcggctagtccaggccaggagcaggactcg
ttcc
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved