Tetraodon_nigroviridis Locus RPL5
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis RPL5
Tetraodon_nigroviridis
RPL5
15
SNORD21
2271..2369
4232
ATCTGAGTTCCTGTCTGCAGATTGTTAGATTATGACTGCAGGCATGTTGCAGATGTGAA
GCTTCATTATCTTCTCTGCAAATACAATAAAACACAGTTGGCTTTGAGAGGAGGAGGAGG
AGGCAGGAAAGTTGAGCGTTGCTTTTCTTATCTCTTGCAGACACGTTGGAGTGAACTTCA
CGTCCACCACAACGCCCCACAGCTCCTTACGGACCCGTGTGCTCCCTGCGTCCCACACCT
GCACTCACCCTTTGACACCAGTGTCGCCTGAAGATAACCGGACGGTTGCTCCTTCATTGT
GAAATCAGTTCATCAGAAACACAGCTTGAGTGGCGTCCGCAACAGTGACTTTGAGTTTTC
TTATCTAAAATGTAAAAAACATCAGCTGGAGTGACTCTCAAGAATATCTGAGTTTAACAG
GAAAGCAGAAGATTTGGGTTCCTTTTTTTCTCAGTGGTTGTTGATTGGGTTTAGAGATAG
ATGTACGTCAAACTACTGGCTCATCAATTCTTAAAGAATTGATGAATTTTTTTCCACTGT
GTAAGAAATTATGACAAACTGACAGTTGACCGTTTCACAATTACAAAGGAAAGAGTTCGT
GCAACACATTTTCCCTTTATCCATCAAGAATAGTTACCATTTTTGTATGTGAGCTTATAC
ATGCACAGCCTAATGCTAAATAATTAATAGATGTAGAAAGTAGAATTAGAAACTACCAGT
GAAGCAATCAAACATACAAAATGTGCAAAAAATGGGTTCTGTGTACTGAGGAGCACATCC
ATTTCTCCTAGAACCCCATCATATTCTCCATTATTTAAAAAAAAAATGACACAGATAATA
ATAGTAGTACGTACTACTTTTAATTCTCTGAGAAAACGAGCCCCTGGTCCTACATCTGCC
TCTGCTGCCCCCTACCGGCCCAGCGTGTCGTTGCATCCGCCATCCAGTGCGGCAGGGGGC
GCTGTTGCCTGCGAGCAGCCGGCAGCACCCAGGTTAGCTTCCTCTTGGAGCTTCTAGCAT
ACTACGGTCGGAGGAAGAGAGTTAAAGTGCCCTAAAATGGTGAGTCAAATGTCTGGATTT
ATAGCTACTTTAGATGAATTGTGTGTCAAGAGAAACGACCAATGCGAGAAAAGTATTTGC
GGTGTTTTGAGAGGCAGATGTTAGTGGATGTTGGCGTCTGTCCGCCGGCGAGCGGCCGAG
TTCCAGCGTGGCGCTTCCATATCTGATGAAACGTCAGATTAAGTTTATAACAGAGATCCA
AGTTTAACATTGTAGTCTTCTAAATGCACACTATGTGTTCATGTGAAGGACAAACATCGG
TCCATTGTTGGTGTCCTTTTAATCCGGCTTTCCTTTTTTGCGAGCATGAATGGCGTTCCT
TTCCTTTCAGGGGTTTGTCAAAGTGGTGAAAAACAAGGCTTACTTCAAGAGATATGAAGT
CAAATTCAGGAGGAGGAGAGGTAAGAGACTACTTTAGAAAGCAGCTTCAAGAACGATTGC
ACCAGTGTGTTAGAGTAAACCTCACAATAATATCCTCGTGTATTTAATATTTATCGGCGT
CTGCAATCCTCTTCCTTTCATTCTGCAGAGGGTAAAACTGACTACTTTGCACGAAAGCGC
CTGGTTGTGCAGGACAAGAACAAGTACAACACACCCAAGTACCGGATGATTGTGAGGCTC
TCCAACAGGGACATCTGCTGCCAGGTCAGGGACCCGGAAGCCCAGAGAGGCTCCTGCAGC
CACGTGCTAAAACTGTCCTGACTCCAGAATCGGTCTCTTTTTCCAGATTGCCTACGCCAA
AATCGAAGGGGACCATATCGTGTGTGCAGCTTATTCTCACGAGCTGCCCAAGTATGGGAT
CACCGTCGGGCTCACCAACTACGCTGCGGCGTACTGCACAGGGCTGCTGCTGGCGCGTCG
GGTAAGAACGACCAAGCACTCGTTTATTTGCAGGATGCGCAAAACGGTGCGTAACTGCTG
TCCCGTGCGGTCTTAGCTGCTGCACAAATTTGGAATGGACCAGGTGTACGAGGGCCAGGT
GGAGGTGACGGGGGAGGAATTCAACGTGGAGAGCGTGGATGGTCAGCCTGGGGCCTTCAC
CTGCTACCTGGATGCAGGTCTGGCCAGAACCACCACGGGGAACAAGGTCTTTGGTGCCCT
GAAAGGAGCCGTTGATGGAGGCCTGTCCATCCCTCACAGGTCAGGCAAGTTCGTTGTTTC
TAAGTGAGGGTTTTAGGGAATTTGTTTCCAAACTTTTGGTTCTGATTTGCTTCTTGATGA
TGATACAAAGAACGCTGAGCAAAATGTAGTTGGTCCTTCATTTGCATTAGCTGATGTCTA
CTGTCCTTTCAAGACGGGGCTGAGAGAAGTCAGATGAACCGAAAATAACGCGACGAACGG
CTTTTAAAAGCGCTGAAACAGCCTGGTTTGGTGCGAACGCCTGAGCCGTGTCTCCCTTCT
CTGGCAGCCTGAAGCGCTTCCCCGGATACGACACCGAGAGCAAAGAGTTCGACGCGGAGG
TTCATCGCAAACACATCATGGGCATGAACGTGGCCGACTACATGTCCTACCTGATGGAGG
AGGACGAGGACGCCTACAAGAAACAGTTCTCTCGCTTCATCAAGAACGGCGTCACGCCGG
ACACGGTGAGACGGTCCCGTCTGCAGGCGCCGCCGCCGGTTCTAACGCTCAGGTTCTCTG
GATCGGAGATTACGGGTGAATGTACGGGGAAGGTCGATCACGCCTGTGCGAAAGCGAGAG
GAGCCGTTGCCAGGTGTGAGAAATGGCAACCCTTGACGCTTCGTTTCTTTTCCCCAGGTG
GAGGAAATGTACAAAAAAGCACACGCCAGCATCAGGGCCAACCCCGCGCACGAGAAGAAA
CCCAAGAAAGACGTCAAGAAGAAGAGGTGAGTTCAGAATTCCCCGTTTTCCCCTTGAAAC
CGACGTCAAGGACTCTGAATGTAAACTACCAAAGCGGTTGACAAAGCCGGCTCGAAAGGA
GGGACGGGGAAATGAAAGCAGCCCGTGTGCCGGCTGAATGCTGATGCGCCCGCTGTCGCC
TCTCTTCCGGCAGGTGGAATCGCGCCAAGTTGTCTCTGGCGCAGCGGAAGGACCGCGTGG
CTCAGAAGAAGGCCAGTTTCTTACGAGCGCAAGAGCAAGAAGCGGGCGACGGATAGGGCT
CCAGTGCAGCGCCGCGCTGCACCACAGACGAATAAAACCGATTCCAGACACAAGTTTCTC
TCTGTCAGCAGTTTGTTGAAAGACAGGGACAAGGCGGAGAGGTTGGTGATGTAGTGTGTA
CTTTAATTGTGCAAAATCATGCTCTGACATTTAGGCTTTTGCTGGAAACCTTTGTCAAAA
ACAGCAGCGTGGATCGCCACGGTGACATGCGCCGAAGCGTCAAGCGGCGGCTTTAGCCAA
GCTCGCTCTGGCAGTCGCCGTCAAAAATATGCAGATTCGTTTCCAAACCTGATAAAGTTC
TTCCTCAGCATCGGTGAAACAACATTCAGGTGACGTCAGCGTGGCCGAGACCGTGTGAGA
GCAACATCAGCAACATGGTTTTCATGTAGAGGGGAAACATTCAAGTGTCACAGATGAAGG
ATGCTGGTTTCGTTTCAACCGTTAGTGCTTCTCCTGCATTACCGCCATTTTCTGGACATT
GATGCGGCTGTTTGGGGTCACAGCGTCAGTCCCAGCGAGGCCACACGACTACCATGAGTC
CAGCACAGGTGAACCACACAAAACAGACTTTCGGAGACAGATTTGTGCCACAGAATCAAA
CGTCCGTGTTTGTCTGAGTTGGAAATCCGAAGCCTTCAGCGCGCTCAGGACCGGAGCGTA
GCACCAGAGTCGCCCGTTTCTGAACACGACAACCTCCCACGAGATGATGAGACGGCACCA
CTGCAGTGAAAACAGGCAGCCGGATCTCTCCGGACAAGTACCGGTGAAGTAAGCGGATGT
GGTGGTTTTCTGAGAAGAACATCAACAAAGTCCAGGTGAGGTGAGCGGCGTCGGCATGCA
GGCGGGGTCCTCTGCCAGCGGAGCAGCTTCCAGGCTAATCGCATCCATTACTGTTCAGTT
TGCTGCTCCTGAACGACCCTTTCAACCCTGGGCTCCCGAGCAGCTGATGGCGTGCCGGCA
GGAGCGCGCCCCCCCCCCTCGTCACGAGTCCTTGGTGTGTGAGATCTGCCTCCACAGCAG
CGCTTTCAGGTTGTTGAGGATGAGCGAGTGCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1058, 1390..1459, 1588..1703, 1786..1920, 1996..2198, 2467..2644, 2817..2905, 3073..3232
1035..1058, 1390..1459, 1588..1703, 1786..1920, 1996..2198, 2467..2644, 2817..2905, 3073..3175
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved