Tetraodon_nigroviridis Locus eif4a2
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis eif4a2
Tetraodon_nigroviridis
eif4a2
15
SNORD2, SNORA81
1325..1399, 2561..2744
5256
tcagagacgccgtagtgaccgaagtactacttgcttgctgcaacatccatccgctgata
taagtagtgccgagtgttttttaaccttttcttcggtaattttactcctaagttgtattt
atacggttgtggatgtattctaactgtttaaaagcatgaggccggtcaaatgaggcgata
gtttaggccaaattgggcatcgagtttcacgttgaaacgagtccggctgcataaaggcaa
taggcttcaccgtcaacgatctttccagtcgcatgctcaggtcgggaacggatcatgtct
agcgattctgctgattacaacaggtaaaaataccacaaaaatccttattttgacacatct
accaccgtttcgtgtttgtaaaagcgtcgccgtagtttggggcgctcgcctgggccaaat
ttgtaaaggaactcgccctgctaagtaggccgcaaccattatcctggtctaaaccgttag
ctctaactgacacggtgtcatcgcgcttttacgttaccgtaaaaggccacttacgtttaa
aaccaccttatttatacacgtcgagacgtccaccccaacggcacggttgttttcgtgtga
atcgagcgggttttgggtggtttccaccggtgccggcgtgccttagctagctcggctcta
ttataaggcagtggtggcacaggcctgattgtccgacatattggctaataggaggaagct
gaactccatgttgagaacgcgccgccgaacgtgttcgcgggcctcaaaccaccccattcc
tgggttcatttcaatcaccacggctgcgggtcgaggggcgacggtttcgggctggtataa
tcggggtttgggggcggagcgggtagtttgtccccgctcgcggtgtctgacacgtgcgct
cggcgcccgtaatgggctcctctgggcggacaccggagctccgaggagcccccggcggcg
cccctgacgtcagatcaccgccggctaaccgcagatctgctCTCTCCCGCAGCTCAAAAG
ACCATGGGGGGCCAGATGGAATGGAGCCTGATGGTATCATCGAGgtacgagcttggagta
atccatccgacgcgaattcgtgggtttgactttacgtgtctaatcttttttttttttttg
gttcgttatttcagAGCAATTGGACCGAAATTACAGACAATTTTGATGACATGAACCTGA
AGGAGAGTCTTCTCAGGGGAATATATGCGTATGGTTTTGAAAAGCCCTCTGCCATTCAAC
AAAGGGCCATTATTCCTTGCATTAAAGgtatggaaacttcttcctgcgattactaaatta
tctctgagtgatgtgatgcttaaccatctttcgggacttacccattaatggggatacttt
tttattttcactgatcactctatccggtttttagaatcgcatgttgtgtaaaattaagat
gtattttaaaactgtcccaatttcccactagGTTATGATGTCATTGCCCAGGCCCAATCA
GGTACTGGCAAGACGGCCACGTTTGCCATCTCCATCCTGCAGCAGCTGGAGATTGATCAG
AAGGAGACCCAGGCCCTGGTGTTGGCTCCCACCAGAGAATTGGCCCAGCAGGTAACCCCC
ACATCTCCTCTCTAgacgtttaaacccgccgtgggcgcagcgatatgatggcataccatc
tttcgggactgacttttacagTGGAGATGTTTTACCCTTAACTGATCGCTCAACTGCTGC
GTTCAGCCTCCTGTCAGTCGATTCACCGGCgtgaattnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatgagg
aattttctttatcgatgatattgaactgcattgtctgattgtacattacTTTGGAATGTG
ACCGTAGTTCCGGAAAGTGTTGCGTTCACCTCACCCAGAGCGCACTGATTACTGAAAAAC
ATTGTTGTTTTATGCTACGCTTCTATAGTCAATACAGttaaaggcttgacgatggtgtag
catttaatttcatcaccacactcacaacaggtaatctccccagcgtaaggtcacggtttg
cacgtcagAAGTAGGGGACAGCTCCACCCAGGAGCTTTTGATCGACCCCAGTTCTTCCAG
AAACTGAGCACAAACATCCAAgtgagtactgtagccagagtcgaggctgccgtccctcca
cgccaacagaaatctgccatacgtgtgcgatccggatcatctgtttcaaacactgctgct
gttcaatgtaatgttcattgacgttcaccttgaggcgcggcgccaccttaggctcggatg
tctcatgctcgtatttattcgttgccaccgctcctccagGTGGTTTTGCTCTCTGCCACC
ATGCCAGCCGAAGTGTTGGAGGTGACCAAGAAGTTCATGCGGGATCCTGTTCGCATCCTG
GTGAAGAAAGAGGAGCTCACCCTGGAGGGTATCAAGCAGTTCTACATTAACGTGGAACGA
GAGgtgtgtgtgttttttgtctttttaaagcgaaacggaagccttccctccaaaagcacc
ctgctggaactgcaggagccgcacctcgctggtccggctcacgtggctgtgtaagcacgg
gtacaccagggaaggagagcaaaggcacggggttgaagacgagacagcgaggggcctctt
tcttaatgtccagtgtcttctgtctcaaggccccgtgtcacatgaccatggttcctgatg
tttaggcgcctagctgtgactcggtcctagcatggttgctctcttgtccccagGAGTGGA
AGCTGGACACCCTGTGTGATCTGTACGAGACGCTGACCATCACCCAGGCTGTCATCTTCC
TCAACACCAGGAGAAAAGTGGACTGGCTGACAGAGAAGATGCACGCCAGGGACTTCACCG
TCTCCGCTCTGgtattttcatctcctgccgctctcggcgtctcttttttccccccgctca
ccggcctctccgttcgcagCATGGCGACATGGACCAGAAGGAGCGCGACGTGATCATGAG
GGAGTTCAGGTCTGGCTCCAGCCGAGTGCTGATCACCACTGACCTCCTGgtgagtgccgg
cgtgacgcttcaacccaaaatgtcctccgagctgcagccgtcctgaaatgaccaagcaga
cggaccttttgggagatcagggctcgttctccacaacgggctcctctgaaataggagccc
gttacttattaacgagcaacacgactcaggccgctgcaggtcctgcagccccaggtgtaa
ctgagcttctctgctgtctgcagGCTCGTGGCATCGACGTCCAGCAGGTGTCCCTGGTCA
TTAACTATGACCTTCCTACAAACCGGGAGAACTACATTCACAGgtaagccgccgggcgag
cacagacgcgtgcgtccaggtgtcccgtccttgggtttaacgcggccgtcctcgtcccca
gAATTGGTCGTGGTGGTCGTTTTGGCAGAAAAGGCGTTGCTATCAACTTCGTCACCGAGG
AGGACAAGAGGGTTCTTCGCGACATTGAGACGTTTTACAATACAACCGTGGAGGAGATGC
CAATGAATGTGGCTGACCTGATTTGAGCCCTGAGATTTTTAAAAAAAAAAATACACACAG
TGATAGCGATCGTCCACTCGCATTGTGCTTATATTATTCGAGGGGGGGAAAAACTTCTCA
ATGCTAAACCTTGGATCAGAATTTTGGTATGTATTAAAGTGAGGCGACTCTATGCTGGTC
CCTCTCGGACTGTCGTAGATTCTAACCTTGGCAGCCGGTTGGTTAGAGATACAAAGACAT
GGGGTCTGTAAATGTAAAGGTCCTAATCAGGTATTTCTTTCCATGTTCAATTAAAGTGTG
TGTGTTTGATGTTCTCCATCATTTAGTAACTTACTTGTGGACTAAAAGGTATAAATGCTG
TATAAAGTCTGCAAATTACGTCATGCTAACATATGTGCGGTGTATTGTGGGCCTGCTAAA
TAGTCATGTTAAACTTGTAGATTCACTTGCTTTTTGTTATATTTTGTGAGTGTTTTAATT
TAATTGTACCATATTTTTTTTTTTATCCCACTGGCTCTATCAAATTCCTCACTGGTTGGC
CATCCCCCGCTGACGTGTGGTTTTACCCTCAGAGTTTATTGCTCTTTACCCCCCTGATTG
ATTTTTTCCAGAGTTACTCCATCCCCAGGTTGTGTGAATGTCTTAATAAAATTGAAAtcg
ctgtaaaactgtcggtttttccgccaaagtcgcctccccgccggcgaggccgcttcgaag
accccttggcggtgctccggtaggaaaggtaactcgaatataaccgttaatttaggtgaa
aaaacaaacaattagctcgaccccattaaataaccgagacaaagcacgaccaaaaatgtg
cagtgcgctagatatattttttaaaaaaaacaaacctgggtatgttttcaggtgtgtttg
gtggaagttcagtggcggaggttccaaccgtgagacttagggcctcgtgtcctggggctg
tagtagcgccccggcgccgccagagggcggcgtcgccacaccgcccgctctgatctttac
ggtaaacctgaacaacttgacagtagcgccccagaactaatgatcacatgcattttaagc
aaaagtataaggttttatttgacaatagagcgaaacaaactaaaagccattcatccatta
tgcaaaaatttttccacagagtgtgtgtgcgcgcgcgatatgcttcagaaaaatgaacag
cggcgctctggtccaacctccatcccttcgtttctgccgtttgtcctgaggagaagagtg
ttttttgcgcgcgttcccccccaaaagcaaagaagcacctggtatagtcaccgcctgcag
ttggaatcccccttagggaagtgcagcgtgctgctccaacggtcagaggttgcaataacg
cacgtatttcctagcaccaactgcggttaacctaaggaggaaatgagcaaagcctccttt
tccactgctgtagaagcagacgtgtgcaaactactttccttcttttgttaattgttatat
taagagtttggtgacgtttcaaagatttatccgctgtaaatcagcttaggagctttgctt
tccagactgaccttcagtaaccgtaaaaagttcaacttcctgcactttttcgtgctcttt
ggccccctttttgtgtgttttaatgtgcgttgtgttg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 1154..1286, 1471..1633, 1701..1769, 1909..2016, 2108..2180, 2379..2522, 2813..2950, 3019..3108, 3323..3402, 3481..4256
1001..1063, 1154..1286, 1471..1633, 1701..1769, 1909..2016, 2108..2180, 2379..2522, 2813..2950, 3019..3108, 3323..3402, 3481..3625
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved