Tetraodon_nigroviridis Locus rps7
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rps7
Tetraodon_nigroviridis
rps7
14
SNORA73, SNORA73, SNORA73, SNORA73
1942..2159, 2505..2721, 3161..3379, 3845..4061
5245
ATGTTTGACCTTTTTGGCTTGTGCCTCTTCCTCATCCTCACCTGAGTGACTCCTCTTCT
TACCGAGGGGGATGTATTCCAGAGCCTCAGGGCCTCTTTTAGGAAGCAGGCCAACTCCGG
ATTCCACAGCCTGAGTAACTGAAACCCAGAAAGGATCGAGTCCAATCGGAATGTTCGGAG
GCAGCTTCAGCCGGCCTTTCCCAGCTGCTCCCAGCTCTGAGGCCGAGGAGAAACGCTACC
TTTATTGGTCCCTGGAGGTGCAGAAGGCTCAGCGCCTCTCACAAAGGCCCAGGCTTCGCG
CTCTGACGCAAACTTCTTGAAAGATGCTGATGGAAATTTATCCACCTGACTTTTACATTC
GTCCCTGAAACAGGAGCACATAAACCCACGAGTGACAGCTGGCGTTAATGGTCAGGGTTA
TGTTGAGGGACGACATTAAGATGACAGATTTGGGAAAGTGGTCACCAGGTAGTGTAGACC
CCGGGTTGCAGTCCCTTCTTTACGGCGTAGAAAAACTTGCCTTTGGCCATGTCGGCGGCG
GCGCTGCAAACGCTCCTGCGTGCTAGGGTGAGAAGACCGCTCAGGTTAAACATTACGATA
AGCCACGGAAGTGAGGTGACGCCGACATGGCCAACAGCAAAGTTAGTTCATCCAATAATG
GCTGCTTCACCGGACTGGTCCCCGTGGGAGCGAGGAGACGCTGCAGCTGAGTCGCTTCAG
CAAAGCGGCCAAAGACGCCAAGAAGAGTCAAGGCCACGGCAGATAGTCAGAACAGCGCCG
ACCAAAATAAGTATTTTGAAAAGGATTTGTGCTATTTTAAGCTCTGTTTTTGTCGCATGT
ATCCAGAACGCTTGGACAAAACCTGTAAAGTTACCCAAAAAACAGAGAGATAAAGACGTC
GATATTATATCCGGGATCACGAAAGTCTCGCGAGGAGTTATGAACTTCCTGCGTGAGCGA
CGCAATTCTCGCGATAAAAACGTCAGTACGGGCTTTGGATTAATACAACTCTCGCGATGT
TTCGGCCTCTTCCTTGGCCGTCGTTGACAGAGGTTAGTTGTGCTTTTTGTGACAAGACTG
ATTTTCTCTTTTAAAATGAGTTTTAACGGTGTTCAGTTATTGTTTTTATGAGCCGAGCAG
CATCTTAGGTCTTTGATGCATTAGATTGAGCAGGTTTTTGTGACGGATGACTGTCTGGTG
GCCTAAAATGAGGCGTAGTAAAGAAGTGCTAGCGACTGAGTCGTCACGGAGCAGCTAACA
GGCCGTGCATGTGTTCGGGTTCGCGGCCAAGCGGTGACCGCACAAGGTGGTGGAGCCGTC
GACGCTGGAGCTTCATGTGTCTGTTACACGGAAACCCAATTTGTAACTGTATTTTGGCAG
ACCCGAACTAAGTGGAAAGAGTGGCTAAATTGCTTTAGCTAGCTAGGACTAGCTTAATCT
TGCCAAGAACTTGGGTTTCAGCTCATTTAAAGCTTGTTTTCACCCGCGATGTTGCCACAA
GTTTCTTCTATCGCGTTCTTGCTGTCCGCGTTTACACCTGAACGCCGAACTTGTTATTAT
TAGTTTGGTTTGATTTTCTCAACGTTGTGAAAATAACCCAAACGTATAAAAATCCTGTTT
GCAGAGACAAAGGCCATGTTCAGTACCAGCGCCAAAATAGTGAAGCCTAATGGCGAAAAG
CCAGACGAGTTTGAGTCTGGGATCTCCCAGGTAAGACGTCCATCATCCAGAGGGCTTTGG
GCCAGGTGTTGCTGTGCGCCTGTTGTTTTGGAGATGTGTCAACCGTTTCCCTGGTTCCTG
CAGGCTCTGCTTGAGCTGGAGATGAACTCTGACCTGAAGGCACAGTTGAGAGAGCTGAAC
ATCACTGCAGCGAAGGTCAGAATCTACGCTTGTGGCCGCCACAATCTTGTCAAAGCTCTG
AAATGTTGGTTTTAGAGCCATTCCGACGTGGACATCCAGCGAGCTGCTCTCCTGGCTCTG
TCCTGGTGGCCTATGGGAGCGTAGCTGTCCGGCCGAGACGTACAGTCCCGTTCCACGCCG
TCGGAGACAGAGCTGTGTCCCCGGCCTTGGCTGGTGTGGACCGGCGTCCTGCATATTCCT
ACATCTTCCCAGAGCCCTAACGGGCCGTTACTGGGGGGCTAAACCATGCAGTGCACAACA
ATATTGAAGTCATTTTAGAAGATTCAAACTGCTTACATTTATTTTATATATCAATCTTGC
AATTAATCTGCACACTGTTGCTTCGGACAGTGAGAATCATTCGTATGTACTTTTTAAACA
AGACAAAAATCTTTTCTCCAGGAAATTGAGGTTGGTGGCAACAGAAAAGCCATCATCATC
TTTGTCCCAGTTCCTCAGCTAAAGTCCTTCCAGAAAATTCAAGTGCGTCTGGTGAGGGAG
CTGGAGAAGAAGTTCAGTGGAAAGCACGTCGTCTTTATTGCCCAGGTGAGGCTGGACGGT
CACGTCAGAGACCTGGAATCAATTGGAGGTGTAGGAATGTTCAATCCGACGTGGACATCC
AGCGAGCTGCTCTCCTGGCTCTGTCCTGGTGGCCTATGGGAGCGTAGTGTCCGGCCGAGA
CGTACAGTCCCGTTCCACGCCGTCGGAGACAGAGCTGTGTCCCCGGCCTTGGCTGGTGTG
GACCGGCGTCCTGCATATTCCTACATCTTCCCAGAGCCCTAACGGGCCGTTACTGGGGGG
CTAAACCATGCAGTGCACATTCATCATCGGGATATTGTCTTCCATTTTATGGAATTTCAT
TTATATTCAGTCAACCATAGACGTAGACTGGGTGATCAGTGTATCAGGGCAGAAAAAACA
GGTTGTTACACGCTGTTGGCACAAAAGCTCATCAAAGTTCTTCAGTTTTGAGTGAAAACT
AAATTGGGATTTTTTTTTTGTTTGTTTCAAGAGGAGGATTCTTCCCAAGCCCACCAGGAA
AAGCCGCTCAAAGAATAAGCAGAAGCGTCCCCGGAGGTGAGGAGTTGACCTCGGAGGTTC
TTGTTGGAATCATCAGCGCTGGTGTTTGGGATGTTGCTCCGGATCGTCCGTCTTTACTCA
TAATGGAGAAACGTGGAGCAACTTTTTAACCTCCACAAGCCTTTTTAGGAAATCTTGGTT
TTCAATTTGTTTTCCTACCTTTGCTAAAACGCGGGTGCGTGCCGACGTGGACGTCCAGCG
AGCTGCTCTCCTGGCTCTGTCCTGGTGGCCTATGGGAGCGTAGCTGTCCGGCCGAGACGT
ACAGTCCCGTTCCACGCCGTCGGAGACAGAGCTGTGTCCCCGGCCTTGGCTGGTGTGGAC
CGGCGTCCTGCATATTCCTACATCTTCCCCAGCACGCTAACGGGCCGTTACTGGGGGGCT
AAACCATGCAGTGCACAAGCCAACTGGGTGGTGGCAAACCTGGGAAAAGCAGCACTTTGT
CATCATTGATCTGCTCACTTGGAGAGTTTGCTTTGATTTGTTAAACGTCGGAGCAACCAA
GCGGGTGACGGTAGCTGTGAGGACCGCGGTCTGCGGGGCCAGGCTGGATTTGGGTCACAG
ATTCAGCGCTGTGGTGTCACCTGTCTCGGGTGTTTTGGGCCTGTAACGGCTCGCATCAGG
TGGTAGATTAGTGGTCATGTGACGTTCAGTGCCGAGGTGTAACGCCGTCTCTGTCTCTCA
GTCGTACTCTGACTTCAGTCCATGATGCCATTTTGGAGGACCTGGTGTTCCCCCAGTGAG
ATTGTGGGCAAGAGGATCCGGGTGAAGATGGACAGCAGCAGGCTCATCAAGGTCCACCTG
GACAAGGCCCAGCAAACCAACGTAGAACACAAGGTGAGTGGCTCTGCTGGTCACCATCAT
GTGTGCCGACGTGGACGTCCAGCGAGCTGCTCTCCTGGCTCTGTCCTGGTGGCCTATGGG
AGCGTAGCTGTCCGGCCGAGACGTACAGTCCCGTTCCACGCCGTCGGAGACAGAGCTGTG
TCCCCGGCCTTGGCTGGTGTGGACCGGCGTCCTGCATATTCCTACATCTTCCCAAGACCT
AACGGGCCGTTGCTGGGGGGCTAAACCATGCAGTGCACAAAGCAGTTTGGTGCTGGGGTG
TAAGTGCTGCCGCAGCCCTTACGTCTGTGGCTAATGACGTCTTTTCATTTGCAGGTGGAA
ACGTTCTCTGGTGTCTACAAGAAGCTCACAGGCAAAGATGTTGTGTTTGAATTCCCAGAA
TTCCAGCTGTAAATGCAGATGGCAAAATAAATTTGTTTACTGTTCAGGTGGGCGTGGCGC
TTCTGACTTGTTTGGGTCTCCTCAGAATATACATGCCGCAAGAGCTTAAAGAGCGAATTT
AAGCTGTAGAAACACCAAAATAACGGCCTGCCGCCACCAGCCCATGGTGGTGGGAGTTTT
AATCCAACTTGTGGGAGTTTTATATGTTTTTAGTATTTAGTATTTAAATGCTATACTAAT
TAGTACAGCGTTTAAATACTACAGGTAAAAGGGTGACCTGCGCCCCGTTGACTGTAATAA
CGGGTACTGGCCGCCAGGGGGCGCAGTTGCTCTCGAAAGATGAAGGCGGGTCTGCACATT
TTAACGTGATTGGCGGGACCGTCTATGGGCGTGGTTAGGGCGTGGCCAGCCCCGGGCGCT
GCATCGCTCGCGCCCTGTTCGCCCGTGCGCCTCTGCGCCTTTGAGACAGGGACGCCGGCC
CCGGAGCTGCGGGAATGCAGTGCGTGAGTGCGTGGACGCCGCGGCAGGTGGCGGACTGGA
TGGAAGGTGAGCGCGCACACTGCGGCTGGAAGGCTGCCGCTTCGACTGGCAGCCGTGACT
ACCTAAGGAAGGACTGATCCCACAGCCAGTGAAACCAGTACTCTGGTGCTGTGGCCCACT
TTACCCAGTACAATCTGATGACACACCAGTGTTCTGGAAATATTAATCTGTGTTTTCAGG
AGTTTTTCTGCCGTTTGACTGCAGGTTTTGTGCTTGACGTTTTCTATGGCCCGTGCGTGC
GTGTGCGCGCGTGTTGACGGAGCTTGTTTACCTTTTTTCTACCCTTATCTTTTTTACTTT
CTGACCTGTATTTTTCTGACTTCTGATGGAAACAGACGCACCGGTTTCCTGACCCTGACC
CTGACCCTGACCCTGACCCTGACCCTGGCCCTGGGCCGGGTCACAGGGTTCCTGCTGGCC
ACATCTGAGCCTCACGCCTTTGTTCCGTCACATGACGCCGAAGGCTGCTTACTCTTCACT
CGTTTCAGGGAGCCTTGGAGCACATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 1624..1709, 1803..1874, 2301..2444, 2911..2975, 3661..3812, 4134..4245
1635..1709, 1803..1874, 2301..2444, 2911..2975, 3661..3812, 4134..4211
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved