Tetraodon_nigroviridis Locus Mono:SCARNA13
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SCARNA13
Tetraodon_nigroviridis
Mono:SCARNA13
14
SCARNA13
1001..1257
2257
TTTAAAACTAAAAATGTAAAACAACAAAAAGCACACAAACGCTTGTTTGATTAGTAGGT
TATCTAATCCAATATTGGGAACAATTTTATCTTCACAAACAGAAAACACATAAAAACTTC
CGGGGCACGAGTTCACACCGGAAAGAGACAGCGACACTTTGAAAGATGGCGGCGAACACG
CAGAATAACAACAAGGCGAAAAAAACTGGAGGAAAAGAGGCTCAGCCTCTGATTATCGCT
AAGAGTCCTGCGGAGGAACAGCGGCTGAAGCTGGAGAGGCTGATGCGAAACCCGGACAAG
CCTGCTCCCATCCCGGACAGACCGAAGGAGTGGAATCCCCGGGCCCCGCCGGAGTTCGTC
CGGGACGTGATGGGCTCCAGCGCCGGCGCCGGCAGCGGCGAGTTCCACGTTTACCGTCAC
CTCCGACGCAGAGAGTACCAGAGGCAGGACTTTCTGGACAAGATGTCGGAGAAGCTAAAC
GCCGACCAGAGGTACCTGGATAAGGTGGAGCAGAACAAGATGGCGGCCGAGGACAGGACG
GCGAAGCGGAGAAAGAAACGGGACAAGTTGAAGCAGAAAAAGCTGATGGCGAAGAAGGCC
AAGATGGAATCTAAGGACAGAAAAGAAGGCGAGCCAGACTCCAGCTCGGACAGCAACGAA
GGGGAAGACGACGACGACGAGGAGGAGAGAGAGGACGATGCCGAAGCTCCAAGCTTCATC
ATGGGGAGGAAATGACCCCGTCTGCGGGGGATGGACATGATGGACACACCGACGGGACTC
AGCCCGGCTCCTGTCTCCAGAGGACGTGGACACAGATGCAAACCAAGGACATGCTCAGGG
CTGGGTTTTCAGGGTCTCTTCAACATTGAACTCAACATTTCTGAGTTTTGACTTGCGAAT
TGTGACTTTTTTAAATAAAACATCGAGTTTGAATAGAACCGGAGCTAAACTTTGTCCTTT
CTGTGTCTTGTTTGATGGTTTTAAAGTTTTGCAGCCTTGTCAGTCTGCTCCTGGCAAAGA
GCTGTTGCTTGTGGGCACATCAAGGTTGCAGAAAGCATCCCAAAGAATGAAAAGGCGTGA
CTTCCAGAGCCCCGGGCTTCCACGTGCGATCTTCTTTGAACACACTCCTGCTTTCCACGG
CGGTGATGGGCTCCATCTGTAGCCATCACCTTTCTTGAGGCAGGTAGAGGAAAAGCAGCC
TGATATTGTTTGAAGCGGGGGAAGCTTTTCCCGTCAGACACTGTCGGCTGTGACACCCGA
GGCCTCGATTAACGCCGAGACGCTTCATTCTAGGTGTCTTCATGGTGTAAAATAGGGATT
GTAAAACGTTTCTGAAACGTTGGCACTTATATCCATATGAACTGTGTGACATTATGGTTT
AAACGCATGGAAAAAGGGGTGAAAATGTGCTATTTTGCTTTGATATCTGATTTTCCAGGA
AGCGCCTGATGGGCACCTTTGTCGCCCCCTAGTGGCGGGCGGTGCAGCTACTTCATTCCA
GGTACAGCTAACATGGTTCAGAGCACTCAACAGTTCCCACTGATGGATTTTGGCCCCTTT
CTGTCTAAAAATAGATTAAACTGCTATAAATCTGAGTTGTGGAGAGACATAATTTCTTGT
TGCTGCAAAGGGGACTCTGGGATTATTGACTTTATCCACCAGTTCAATAAAATTATCAAA
CTTCTGCAAGCGTGACATGAACTTTCTACCAAAAACCAACTTTTGATGAATAAATTCCCA
CGAGCCCACATTCTCCAGTCTTCAGGAGTCTCTTGACATGAACGGCTTGCTCTTCAGAGT
GTTGTTTTACAGTGAACGCCCCCCCAGCGTCAGAAAGATTGATTGCCTAATCAGAAGAAG
TATCCAGCCTGCAGCCTCACACGCTGGCTGACTTGCTGGGACAGATTTAAACCCCAGTCT
GCCAGTAGGACTGGAGCTGGGAGTGGAGGCCACGGGCGTGTGGAAACAAGACCCACCGCC
TCACTTTGTCTGACTTCTCATTTTGCAGTGAAAACTCAGAGTGGATCTGATTGCTGCGAG
TGTCGACGTTCAAAAGCAAACTCTCAAAGGGGCTCGTGAAGTTCACAGAATGGAGGATGA
AGGCAACGATGATCCACAGAGGGCACCGGAGGGAGGGAGGATGAGTGATGAAGAGGAGAA
GACTGGAGGTAGTGTGAAATGACGGTTTCTGATCCTGTTAAATCAGACATGAACTACTTT
AAACGCACCAGCTGAGCAGGACGGCTCGCGTCTCATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved