Tetraodon_nigroviridis Locus rps12
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rps12
Tetraodon_nigroviridis
rps12
14
SNORD101, SNORD100, SNORD100, SNORA33
1722..1796, 2021..2105, 2307..2388, 2666..2793
3950
AAAGAAAACAGAGATTCAAATTCCTTTTTCTATCCAGCTGCACACCAGATGTTAATAAA
ATAGTTATTTGCTCATCCTAAATACAGATGTATTATACCTGGAAGGGCCACTTTCTGTGG
AGTGGGTCCTGCGTGCACTACCCTGACAGACCACATCTGTGCTGATCCTATACTCACGAT
TTACATTTGAAGATCAGCACTCACAAATCAACAAATAAAGCTCACATTCCAAAAAACAGG
CCTAAGCCAAGCAAATTGCACAATTTTGTTAAAGTAAAGCTAGTGATTTACATAGCACAC
TGTCCTCCTTTTTAACAGTTGTGTTTTCTCTCTCTCTCTCTTTCTTTTTTTGTCAGGACT
ATGAGGCATTTGACAATGCCAACGAAGTGGGCACTATAAAACAGTTTCTCAAACTCAAAT
AAGAATAAGAACCAACTGTGGAACATCAATGTTCAGAAATGTGCTTGTACTTTTCAATAA
AGGTGTACTGGTAAAACTTCAGAGGAATCACTTTCATTGACAGATATGTTCAAAGTATAT
TAAAGATATACTTTAAAAATTGAATTTCCCCCCCCCCCAAAAAAAATAAATAACTAAAAG
ATAAATGAATAAATACATATTTGCGGAGGGGTCGCTTTATTGTATACTTCATCTGTGGAT
TGTCAATATTATTATTATTGTTGTAATGAATAATAATAATAATAATAATAATAATAATAA
TAATAATAATAATAATAATAATAATAATAATAATAATAAACTCGTTGCATAAGTTAACGT
CAGTAATAAACAACGGGTTCAGAAAAACACTCTAAAACACTCTTTTTCATTAAGTAAAAT
AAAACACGATATTTTTAACAAATATTAGGACATTGTCCTTCTGTTTATATCGGAAAAGCA
TAAATATTTATTAGGAAAAAATATACGGCCGGGTTTAAAACGTGCAAATGTTACAGGCAT
TAATTTGAACACCAATGTTCGTAGCGAGTGGGCCTTGTGGTAATAAACCCGTGTCGTGGC
CTGATGACGTCCTCTTTTCTCGATGCCCGATTGCAGGCTTTGGTATGATTTCCAATCATC
GGCGCACTTCTTAGGATAAATTAAGCATCTTATCTTATGTAGGCACTTAAACAAACTGTT
TTGAGATAAATAACACGTATGCTTTCATTTTTTGTCTATATTTCAGAACTTTTAAGTCGA
ACATCCATCTAGAAACAACAATGGCCGAGGAAGGGTAAGGAACGCTATAAAAATTCATGC
TTATCTAGAGTTTAAAATAGAGTTGCTGTAGGTACAACACTTTTAATAGCAGTCGTTTTA
TCATAGTTTAAAATTCAATTTGTTAGGAGGGGTGACTTTAATTTTTGTCTAGGTAGCATG
AGCTACTAGCTAACGCGGCTGGTATCGGTTACCCGCAGTCCGTTTAGCATGGCTTATTAA
AAGACCCGAATACGCTTGTAAACTCTCGCTAAGACCTAAAAGGTGATTATCTTGGTGTAT
GAGAAGTAAGGTAAACATGATACAGCGGTAGAGGATGCATTAGGCTACTGAAGGCGGGCT
ACATCGAATGCAAAGTTCTGTCATACGTGCACGTTTCATAACTTATGAAGTGAGTTGTAT
TTGGTTATGGCATGCATTTAGTACTGTTAGGGGTTTATTAATAATTTGTAGGAATTAAGA
TGTTTATTAAATGTCAATGAATTTCAAGTATGAGCTTCTGGCACTGAAATGATGACTTAA
TTCTTTTGTCGGATACCCCTTCACTCTCCAATGAGTGAGACCCACCTTCTGACCTGCTGG
AAGCCTCCTTCGGTCACCTTAGAACGCTCGGGGTGTGTTGGTCCTCTCTGAACCTCAGCT
TGTTCACAGCGTTGCTGCTGGAGGTGTCATGGATGTCAACACTGCTCTCCCAGAAGTGCT
GAAGACTGCCCTCATTCACGACGGCCTTGCCCGTGGCATCCGGGAGGCTGCCAAGGCTCT
GGACAAGTGTGTTTCACTCTACTTTATACTGTGTTGATGCACATGTCGCTGATGATATCT
TGGCTCCCTCTACTGAGTTTTAATGTGGAAGTCTGCCATTGTTACCCAATTTCTATCTGA
GATGTTTGATTATTCTTTTTTTATTCGATAGTTTGGTGAACGCGTGTTTAGTGTTTGGTT
GAATCTCGCAGGCGTCAGGCCCACCTGTGCGCCCTTGCTGCCAACTGTGACGAGCCCATG
TATGTGAAGCTGGTGGAGGCCCTCTGCGCTGAGCATCAGATCAACCTGATAAAGGTAACT
AGAGCCAAGCGCCCCCTGCTCTGATGCGGCATCACTGATGATAATCTGGCTCCCTCTACT
GATTATGGTGAGGAAAGTGCCACTGTTACCCAATTTTGTCTGAGATGCACGGCTCCCCCT
ATTCAGATCTAAAAACCGAAGCGTTTCCAGTGTCTTATTTACCTGTATTTTATCAAATGC
ATGTTTCATTTATACTACAAGGTGGTAACTACAAGCCTTATGGTTTAGGTTGATGACAAC
AAGAAGCTTGGTGAGTGGGTCGGACTGTGCAAGATCGACCGTGAGGGGAAACCCCGCAAG
GTGGTGGGCTGCAGCTGCGTCGTAGTCAAGGTAAACATAGCCAAGTAGCACGCAGGTAGA
AAAGCTAATGCTAAAGGAGCGTCATCATGCCAGGCAAGTGCAGGTGCTTGTGATTCATGA
CATGCAGCTGTTTAACAAATGGCTATAGGACGGCCAGGGTACGAGCCCCGCCACCTCTCC
GTGGTGACTGGGGTCCCAAAGAACGGCTACATCTGAAACCTTTCTGTGCTGAACTGAAAT
TCCACCTCCTGTAAGACGCTGATCCTCACCGTTCTGCCGACAGGATTATGGCAAGGAGTC
CCAGGCCAAGGATGTGATTGAGGAGTACTTCAAGAGCAAGAAATAAGACCGCAATAAAAT
TTGGAAAGTAAGACGGCTCATCTGTGTTCTCTCCCACGGGGCATCAGAGGAGGTGAAAAC
GCAGAACTGGTGGGAAAATTAGATTCATGCACATTTGGGCACTGGAACTGTTTTTGAATA
GATGACGTCACTAAGGTGATCAGCTGCATGCAAACATGAAGACTTGATGAAAATGTGGCT
TTTAAAGGAAGAGAGGACACACGGGTCGGTTGGATAAGTTCTTTATCTACAGATTTTTGA
AGGAAAAAGCTTTCAAACACATGATGCACATCTCTGACCCCACCCCTGCCCCCAAATTAC
AAAAGTCCAGAACAGAGAACCCAAACTTTAAGTTAAATAGCCACTACCTTGCAACTATAA
TGTAAATAATTTACAGATATTTGTACCACCAGGAAGAAAACCATACAAAAAGATTATTAA
CGCCGGTACTTAAAACTCGGCCCAGGTTCATCCCGAGTGACCCAAGCGGGCCTGGTATTA
GCCCAATGCACAATAAAAACGGTGGTTTGGGTGGAGCTCCTCCAGGCCGACCAGTCTGCT
CCAGCTGCAGGGACCGGGAGGCTCCCAGCATCCAAGTCCCAGTTTTCAGTCCCCGCCGGG
CCCCGACTGCAGAAGCGATCTAAAACCCTGCTGTGTCTCCTGCCTTTCACCTCTTTTAAG
ACCATTCAGTTTGTAAATGAGACATTCCCAAAAAAAAACAACCCAAATTCCAAACTTGCA
GTGTATTAAATAAGAGGGCTGCCCTGTTGACCACGTCCATGGTTGCGAGTTTAAGTCCAT
ATTGCTGTCGGTTACAGGTACTCGAACTCCAGTGCTTGGTGTAGCGCCAGCAGGTCGGAG
TGGCTGGATATCCTCCAGAAGGGCATGTTGTGCTGCAGGGGGGACACGGGCGTTAGTGGG
GGCGGACGCGTGGCGCGCGGCACACCGCCGCCTACTGGCATGCGGGCGGCACTACAACGG
TACTGCACCACAAATGGAACCCATGCACTTCTACTGTGGCTCACACGAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1061, 1186..1233, 1869..1985, 2171..2273, 2508..2609, 2863..2950
1220..1233, 1869..1985, 2171..2273, 2508..2609, 2863..2925
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved