Tetraodon_nigroviridis Locus tcp1
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis tcp1
Tetraodon_nigroviridis
tcp1
14
SNORA29, SNORA29
1331..1469, 1889..2030
5756
TCAAAGCTTGTTGTGCAGGAATTGTGCATCAAATCCAAGACAGGAATGAAGAATAATTA
TATTTTTTATCATACATGTTTGTCCTGTGTTTCGGTGGGTGGGATTGTCAGTCTTTGGTG
ACGCTGTTTTGCACTTTTCTTTCTTTATGTTTAATTTGTAAAACACTTTGTAAAGATGTA
CATTTTAGGAAAATTATTCTTGTATGCCATAGGTATGCTTTATAATGCTTTAATGTTTAA
ATTAAGTTGACTGTTATTTTGTTTTGTTTTGTTTTGTTTTCTTAACTGCCTAGTTGTCAT
TGCTCAACCTGATAACTGTATTGGAAGTAATAAATTCAGATTAAACTTTTCTTTGTGTTT
GTTGTATTTACAGAACTAAACCTGAACATGGCAACATCACAGTTGTATTTGAACTAATAT
CACTGTGATAAAAATACAAATTTAGTAGTGAGAAAATATTAATGCTCAACACAACAATCA
ACTTACAGACTGCATCATACGATTTATGACATTGTTTCAATAAACTTTGAGATTATCATG
TTGGATAATCAAATTAAAAGTACCCTCAAATGGTCATCTTCTGTTCCTTTGTCCTGTATC
AATGTTTCCAAAAAACATTATTCAAGTCCGTAATTTTTTGAGCTATTTGTCTCCACAAAA
AGACGCACAAATAAGCGCCTGCGGTCATTTAAGCTCCTGGGCGGAGGTGAAAATAGCACC
TGCAGTACATCTAAGCCGACAGCAGAGGGCGCATCTGACAGACATATAAAAAGGCATGCT
GGGAAATAGAGTCCATACTGACTCTATGGTTAAAAAGTTGCATTGATTACTGTCATTAAA
GATCCCATTTACGTTAGGTGCAAGTAAAACTGTAAAGTATCTCAACTTTATATAGTAAAA
CATTTGTGCAATAATAAACATTTTGTTTAGTATACGTTTTATTCTCGAACCTTCCGCACA
ATACCGGCTTACCCAGAGTGCTCCGCGGCGCCATCTTTCTTCTTGGTTGTGTGGTGGTCC
AAAATGTCGCTACTAGACGGTCCATTAAACGTGCTCGGCCAAAGAACGACCGGCGATTCG
GTTCGTACTCAAAATGGTAAGTTTTCTTTCTGATATTATTATCTTTAATTTGCTCTTCGT
GTGGTATTTGTATATCACTCTGACGAACCAGATACTTGACTTCCTTTGCCGCTGGTAGCA
CACGTGCGGATAATGCTAATGCTAGCTGACCTAACGTGACGCTCATGTCCGCCTGTATCT
TTAGGTTTATTTCCTGTGAAGCGAGGTCGACATGTGTACCACAAACGCACGTATCTTTAG
GTTTCCAGGATCATCCCATTTCAGTACCTTCCACTCGCTTGAAGATGAATGGATGGCTAT
GCTAATGGGAGAGAAAAACACTGTCATGGTCTGAGGGTGTGGCTAAACTAACTGTGTACC
ACACTAAATATAATGACAGGATATACGTATATTAGATATTACCTTCGTTACTAGGTTAAA
TGTAAGCTTGTTAATGACTGCATCTTCTTTGTGATCTGTGCAGTCATGGCCGCAGCATCA
ATCGCCAACATTGTCAAAAGCTCCCTAGGACCAGTCGGACTGGACAAGATGTTGGTGGAC
GACATAGGAGTAAGTCCCACATTTATACGTAATAAAAAAATATTCAAGACACTTATCTTC
ATTTTTGAACCATAGGACGTGACCATCACTAACGATGGAGCAACCATCCTCAAGCTGCTG
GAAGTGGAGCACCCAGCTGCCAAAGTCCTGTGTGAACTGGCTGACCTGCAGGACAAAGAG
GTCGGCGATGGGACCACGTCTGTGGTGAGTACGAGGATCAGCCGCCTGCCTGCGCTGTTG
ATGCCCAGTGCTTTTGGGCTAAATGCAAAAGTCCTGTTTTAGTACCACTTCTCTGCCTTT
TATTACGGATGTGTGGCTATGCCAACAGGAAAGAGAAGCTGTCTGTCAGTGTCTGAAGGA
GTCCAGCAGTGTTGGTCTGCTACTCCTAAAGAAATGACAGCACATTTTTATAGGCGTGTA
ACTTTCCCCAGTTCACTAGTAGTCTAAATGTGTTAAATACTGTGACCTGTTTAGGTCATT
ATTGCAGCTGAATTATTGAAGAGTGCGGATGAGTTGGTGAAGCAGAAGATTCACCCCACA
TCAGTCATCAGTGGATATCGTCTGGCTTGCAAGTAAGATTCTGTCTTCAACATTTTGACA
GCCTTGTATTTTGACTAGATTATATTTTTGACATGCAAACTTGTTTTTTTTATCTTTCTT
CCAGGGAGGCAGTCCGCTACATTAATGAGAACCTCACCATTGCCACAGATGACCTGGGCA
GAGAGTGTCTAATTAATGCAGCCAAGACATCCATGTCCTCAAAAATCATCGGAGTGTATC
CTTTTTCTCGCAGGCAATGCAACTTTGAAAATAAGCACGGAGAAGAACTTGTGTTGACCT
TAATTCTACCTCCTCAGTGATGCCGACTTCTTTGCTAACATGGTGGTGGATGCTGCCATG
GCTGTGAAGTTTGTAGACAGCAAGGGGGTCGCCAAATACCCCATCAACTCTGTCAATGTC
CTGAAAGCCCACGGCCGCAGTCAGAAGGAGAGCTTCTTGGTTAACGGATATGCACTTAAC
TGTACAGTTGGCTCACAAGGTGCGCTGATTCAAAGAATATGCAAAAATGATGCTAAATGT
TTTATATTGGCTCCAGCTAATTGAACTCCCATTTAATTTTGCTGCTGTGTCAAATGTTAT
GATATAAGCAGTGATACGCGTGGGAGAGAGAACTCTGGCCTTGAGAGAGCCTGGACTCAG
TCGCTTGTAAACTGTTTCATTTCTTTTTTGGCCAGACAGTTGAACAGGATTGCTGATGGC
CATGCTTTCAAGCTTAGTCACTGCAAAAAGATATTTAACACTCTGTTGGTTTTCCCTCGT
AGAAATGACAAAACGTGTCGTCAATGCCAAAATATGCCTGCTTGGACTTCAGCCTCCAGA
AGACCAAGTTGAAAATGGGTGTCCAAGTCATCATCACTGACCCAGAGAAGCTGGACCAGA
TCAGACAGAGGTCAGTTTGCTCTCACCATCACCGTCCCAGATGAAAACAGGCCTTTTTCG
TTTTGCTGTGATGCTGAATAGGTAGTTTACACAGTGGTGGGATACGCGTGGGGGGAAACA
CTGGCTGCAGCAGTTAGTACTGCAGCTTCTGTCTGAGCTGCTGTGCAACTTCTGTTGGCT
GAACAATTGTAAATTCGAGTTGTTTAACTGTGTATTTTAACCTGTCACCTTTTCTTTCAT
TTCTTTCTTTCTCAGAGAGTCTGACATCACCAAGGAGAGGATCCAGAAAATCCTGGCAGC
CGGTGCCAACGTTATCCTCACCACCGGTGGCGTCGACGACATGTGTCTCAAATACTTTGT
GGATGTGGGAGCCATGGCAGTGAGACGGGTTTTGAAGCGGGATCTTAAACGCATCGCCAA
GGCAACAGGAGGTATGCTGATGTTTGTGGGGGCAGAGTTTGTTTTCCACCTTGGCGTGTT
CTTGTGGGTTTGATCACAGGGTAGAATTGTTGTTTTAAGTCCAGGAAAAATGCAGGTTTG
TGTTTGTCACTCTTGCAGCAACCATCTGCCCCTCTCTGACAAATCTGGAGGGAGAGGAGA
CGTTTGAGGCCACCATGCTGGGTCAGGCCGAGGAGGTTGCTCAGGAACGCGTCTGTGATG
ATGAGCTCATCTTGGTCAAAAAGTAAGAATATTGATTGTAGCTCCTCGTCTGGTGCTTTT
TTTTTAGGCAAGAGACATTCTTTGGTGTGTTAACTTTGGCTGTGTCTTCTCAATTGGTTC
CGGCAGCACCAAAGCACGCACATCCGCGTCCATCATTCTGCGCGGGGCCAACGACTTCAT
GTGTGACGAGATGGAGCGTTCGCTGCATGATGCCCTCTGCGTGGTCAAGAGGGTGTTGGA
GTCCAAGTGCGTCGTTCCAGGCGGAGGTGCGGTGGAGGCTGCTCTGTCAATCTACCTGGA
GAATTACGCCACCAGCATGGTGAGGTTAGGGTTCAGCGGGCAGCTGCTGGGAACCAGGAG
GGGATTTTTTTCTTTATCCCATTTTATGTTATTTAATTTTTTAGGGTTCCCGAGAGCAGC
TGGCTATTGCGGAGTTTGCGCGTTCCCTCCTCGTCATTCCCAAGACGCTGGCTGTGAATG
CAGCCCAGGACTCCACCGACCTGGTGGCCAAGCTCCGAGCTTTCCACAATGAAGCTCAGG
TTAACCCTGAACGCAAGAACCTCAAGTGGTGAGCATCTTCATTACTAAATGACCAAATCA
AAACTGAGGCCAACTTTTTTTTAGGTTGGGGAAGCAAAAAGATTAGTTGTAGATCGACAT
TTTCGATATTGGTTGCAGGATTGGTCTGGACCTGGTGAACGGCAAACCGCGAGACAACCG
TCAAGCCGGCGTGTACGAGCCCATCACGGTCAAGACGAAGAGCCTGAAGTTTGCCACAGA
GGCCGCCATCACTATTCTCCGCATCGATGACCTCATCAAATTATTCCCGGAGCAGAAGGA
GGACGGCCAGTCGTACAGAGATGCCGTGCAGTCTGGTTCTCTGGAGGGTTAGGAAGCTTC
TGTCGGTCGTCCAGCTTCAGTCTGTATGTATACAAGCAGAGCCCTGTGGCTGCGGCTCTA
GTATAGGCTGTGCACTTTGCCTGGTTACTGTTCTCCCTTTTTTGAGTTTTGTCGGACAAT
TAATAAAGCTCCAGTGGCTGGAAGTGACCGTTGAGTTTTTAATTTGTGCTCACTGGATGT
TGTGGAGGCATTGATAAAAACCCTTGAGGGGTTTTCCCACCACTTTATTGATATGTTGCT
TAGTTACAGGAGTCGCTGTAATGGCCGGTAAGTATAAGGTCCCAAAGCTGCTGAGTGGAA
TGTTGATCAGGATGCTTTGTTTTAAAGCAGTCAACTAACAGGTTTACGTACATTTAACAA
CCTTTTAAATGTGTTAATTACATATTTCAGTTTACCTCAAGAGATAAATGTTAATTATAA
AATACTACATTTTTAGTGCTATTCACAATATTTCTGTAAAGGGAATACTTAAATATACAG
TTGTACAGACCTGAGCGCTTCATGCACAGTGAGACAATTTTACATGGTCCAGCTATTTTT
TTTTAAGAGTGTAGAGGAGGAGTGTAGAGGATTTTTTACTCACACCTCTTCCAAGTAAAT
CAGTGAAACTCAAAGTCTCTCCACACACATGGCGATGCCCATACCTCCACCGATGCAGAG
CGAGGCGACACCTTTTTGACCTCCCGTCCTTTGCAGCGCGTGCAGCAAGGTGACCAGCAC
TCTGCAGCCAGACATGCCGATAGGATGGCCCAGAGAGATGGCGCCGCCGCTCACGTTCAC
CTGGAGATGAAAGGCGTGTGTTAACGTGAGCAGTCCCCACTGCAGCTTCGGTCCATAGTG
TGTCACACTCCTACTTTGTCTGCGCTCAGAGCGAGCTCTTTCACCACAGCCAGAGACTGA
GCAGCAAACGCCTCGTTGATCTCAAACAAATCCACTTGGTCCAGCTGCCAGCCTGCTTTT
TCCACCTAGCAAACAATTATAACAAAGGATTATTATTGTTTCATGTTCTCGTATTCATGT
TCCTGTCCGAATTCTCACCGCCGTCCTGATGGCCGGTATCGGTCCTGCTCCCATGACAGC
TGGTTCGAGGCCAGCTTGGGCTGAAGACACAACTCTGGCCAGAGGTTTTATGCCACG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1095, 1543..1628, 1695..1823, 2094..2191, 2284..2394, 2477..2658, 2942..3069, 3315..3490, 3618..3741, 3846..4037, 4123..4287, 4398..4756
1023..1095, 1543..1628, 1695..1823, 2094..2191, 2284..2394, 2477..2658, 2942..3069, 3315..3490, 3618..3741, 3846..4037, 4123..4287, 4398..4611
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved