Tetraodon_nigroviridis Locus kif23
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis kif23
Tetraodon_nigroviridis
kif23
13
snoZ30
3187..3283
7329
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGGAAAGTTCAAAATTGTA
GGATTAACCGTGTTTGCTTTAATAAGAAACCGGTAGCCAAAATGACCAGGCCAGCGTAAG
TATTACTTTTTTAAACTCAAGTTTTCAAGTCAAACTTTGCCTGCATGCGTTACGGTCAAG
AATCTTTGTCTTTGTGTGGTCGTTAGCCGCGCTGCTTCATTAGCACATTGTTTACTGTGA
GATGAAGCTAGCGTTAACAATGGGCTGTTTATTCCAGGAAGGGTAAAACACCTCGCAGGC
CTCCTCCTAAAAAGCCTTCTAACAACCAGAAAGACCCAGTTGGGGTAAGTTGTCAGAGAT
TTTTTAACAGACGAAGCATCACAAGGACTTGTGCAAATCTTAGCTTTCTATTCAAGAAGT
TCTTCGTGTGGAATTTTTTGAAATCTCACGATCGTGAAACGGCAACACGTTGATAACATT
AGTCTTGTGATGTATATGTGTTGAGTTTTTTTTAAATTATTATTTTATTTTCCTCAGGTA
TACTGTCGTGTGCGACCTCTTAGTGAAGAAGACCGGGAGTGCTGCATCGAGGTGATCAGC
GGCTCCAACCGTCCAGCTGCATCCTCCCGAGGGCTTCAAAATAAGCCGAAATGGAGAGTA
CAAAGAGGTACCGAGAGCACTTACCATGAGGAAGGTCACTAATTCAGTTCGTAGTCGGGA
TACAATAGGATAATATTTAGGGTATTTCCTTGAAAATGTCACAGAATGTACTTTATTTTG
TTAAATTGCAACTCAAAAACCCATAACAACTACTAAATGAGTTAAATACCAGTTTTACCG
TGATTGTTGCCAGATTAACCGATTTGTTTTCTTCCCAGACACAATATTCCTTTCAAAAGG
TCTTTGGAGTTTCAACTTCTCAGACAGAGCTGTTTGAACAAGTGGCCAAAGTTCTTGTTG
AAGACCTCATTCGTGGGAAAAATGGTAGGAACGCGCAACTCTTTTAGGAATTGTCATGGA
TTGAATCTCAGATGTTTAATTTCATTTCTCTGCATAGGTTTGCTCTTTACCTATGGGGTA
ACGGGCAGTGGAAAGACTTTCACAATGACAGGGTCTCCAGGCCAGGGCGGACTTCTCCCT
CGTGCGCTCGACATGCTCTTCAACAATATAGGAGCCTTTCAGGCCAAAAGATTTGTAAGG
AGATAGATTAAAAGAAAAATACATTTGTGAATAATGCGTTAAACATTTCTGCACACTTTT
ATTTTTCAGATTTTTAAGTCAGACGACAAAAATGGTATAGAAATCCAGAATGAAGTTGAT
GCCTTGTTAGAACGCCAAAGACGGGACAACAACCTGACTGTTCCTAAAACACCAGCCTCC
AGGTACGACCGGTGAATTACCAGTGTCTCAACTCTGCCTGTCACAGAAATCAAAGTTAAC
CCAGCTGATTGTTTTATTATTTTTTCAGACAAAAGGACCCTGAAATTGCTGACATGCTTA
CGTCTGATGAGGCCTGTAAAGTAGATGGCGTGGACGAGGACAGCAGCTACAGCATTTTTA
TCTCCTACATTGAAATCTACAACAACTACATCTACGATCTCCTGGAGGAAACGCAGGAGG
ATGCATTTAAAACAAAGTGAGTTAAGGTTGGCTCAAGCACAAGTACTCATTCCAGCTGAA
TGAGCCAAGCCCGTAATGATCTGAACAATGTTACAATTTTTAAGGACACAAAAGTAAATG
TGCCCTATCTAGAATACTGAGAATTTTAAATTCATGTTGGAGGATGTGTGCAGCCAGGGG
GGTAAATTATTTCTTTTTTCCTGCTAGGTGAAATGGCTTCGTGTCTGAGTCTGAGTTCAT
GCATGTGACCGGTGGATACTCGTACTAGTCCGTTTCAGTGAGGTTGGGTAGTTTTGAATC
CACAGACGACGCACACAGCAGCCCTCATTGTTGCGCTTTAGTCCTCTAGTATGTGGTTGC
TCCCGTCTTCTGCTTGCAGTCCTCGCAAGTCTGCTTTATTCCTGAATGTCTGTTGCTTGT
GCTGCGCCTAGTCAGATGCAGCGTTTTTCTTTTCCAGTGTGTGTGTTCTGACTAACGGTG
GAATTTTCTCAACCTAGGCCACCTCAGTCCAGACTCCTCCGGGAGGACCCGAATCACAAC
ATGTACGTGGCCGGCTGCTTGGAGGTGGAGGTCAAATCTGCTCAGGAGGCATTTCAGGTC
TTCTGGAAAGGTAGATTATCAGATTGGCTTTGAGTTCTGTGTTTAAGACGAGGGCGGAGA
GAAAACTCTGCGAGGATGACTGTTGATACGACTGACCTGGCAGTGCCGGCCTCCGGGTCA
GCTCTGGCCAGGAAATGACACCTGTTAATCTTCTCTCTGAGCAGATGAATGAATCCGGTT
GTGCTGCGACCTGTTTTTGCCTGCGGGTTAAACGTGTAATTGGGCTCATGTTGAGGAGTC
TCGCCTGTGTTTTCCAGGTCAGAAAAAAAGGAAGGTTGCAAACACCTGCCTGAACCGAGA
GTCCAGTCGCTCCCACAGCGTCTTCATGATCAAACTGGTCCAAGCTCCCCTCGATGCTGA
TGGCGACAACGTGCTGCAGGTTTGTTGACGTCATTAATGCGTCTGTCTGCAGCTCTTCGG
TTCCCGTTTATGGGATGTACAACCGTAACTTTGGATGCTTTCTGATGTTGCCTGACAGGA
TAAAAGCCAGGTGGCTGTGAGTCAGCTGTGCTTGGTGGACCTGGCAGGGAGTGAGCGAAC
TGGACGGACTGGGGCAGAAGGCACTCGCATACGGGAAGCAGGTTGGTTGTCAAAACCATT
TTTTTCTCCTTTTCTCACCAAAAACAAAATGTGATTAAATGTTATTTTGTATCTCGCAGG
CAACATTAATCAGTCTTTGCTGACTTTGCGCACCTGCATTGAAATCCTTCGGGAGAACCA
GATGTACGGCACAAACAGGGTATGATCACAGCAGCGGAACACCGGTGAATGTAATGGCTA
ACAGTACAGGTAACCGAGGTTCTGTCTGACAGATGGTCCCCTACAGAGACTCTAAACTCA
CCCTTCTGTTCAAGAACTACTTTGATGGGGAGGGAAAAGTCAGAATGGTTGTTTGTGTCA
ACCCCAAGGCTGATGACTACGAGGAAACGCTGGTAAGTTGGTCAACTAGCCACGAAAATG
TCCGCTTGCCTGCTTTCTTGCTGAGCTGTGCTCCTCTCTCCCAGCTGGTGATGCGGTTTG
CAGAGGTGACCCAGGAGGTGGAAGTGGCTCGGCCGGTGGACAGGCCGATCTGTGGCTTCA
CGCCAGGCCGTCGCCACCGAAACCAAGCCTTTAAGGAGGAACTGTCTCGCAAGCTTGAGC
AGCGTGGTGGTCCACTAGACAAAGGCAAGTTTTCCCTCATCAACCGAGATCAGCTGGCTC
GAAGGTTTCTGTACATCAGATACTCCTGTTTTTGGTCCTGTTCCGAAAGTATAAACAGCA
GCCGAGTTTGTCTGTTTTCCTTAGATGTGGCGTCCGTTATAAGCCCCCTGCTGCAGAACC
TTCCTCCTCTGCCCTCCTGTGAGCTGACCGGCCCCCACGATGACGCCACCCTGCCCCGAC
TGATCGAAGCTCTGCAGCAAAGACACAGGATCAGGCAGACCATGTTTGAGGAGTACAGCA
GAGCAGGTGCCGCTCACCGCCCTCCGCTCCTGTAGATGCTGGAAAAACCTGGAAACGCTG
CTCGTTCTCACCTCTGTTGTGTTCTTTCAGCCGACACACTGAAGTCCCTGCTTCAGCAGC
TGGACAGCAACCAAGCAGCCAAAGAAAACGCTGTTCAGGAACAGAACGACAAACTGTCTG
AGAAGGACAGACTCATTCAGAGCAACAAGGCAGAGATCGAACGTTTGGAGAAGAGGACAA
AGATGTATGAACACAAGGTACAAGACAGAAAACAACCGTCTCTCAGTCCCTGGGTGATAG
GTGTGATTTGATTTTTTTCTTTTACCAAACAAAAAGTTGGTTTTCTTTTTTTTTTTTTAG
ATTGACATCCTGCAGAAAACCACTAAAATCTACGAGGATGACAAGCGCATGCTGCACAAC
GAGCTGGAAACCAGAGAGCAGAGGCTGCAGCGGGAGCTGTCTTGACAAGAGGCGCATGGA
GCAGCGCCTGCACGGAGCCGTCACCGACACGCAGCTCAAGTGGGAGAAAGAATGTGTGAG
TCGAAGCTCCGCCCGTCGGTTTGAGTTAAATCGACCGTTCAGTACTCAGCCTCCTCTGTC
CCTCCTACAGGGCAGACGTGTGAATGTCATGCAGATGGAGATGCAAAACAAGCTCCTGGT
GAAAGATGAGAAGCTGAAGCAGCTCAAGGCCATTGTGACGGATAGCAAGACTCGCGGTCG
CCCCGAAGCCCCACCGCGTCAGACGCAGCCCACGCGTCCTTCCAGAGAGGAGCGCCTGCC
TGCTAAGCGATCGGCCTCCCCGTCTCCTCTCCCTGTACGTATCAGTGACTGAAACATGGC
GTCTCCACAGCAGATGTTCCACCTTTTGCCTCCTGGTCCTGCAGACGTCGACGCCGGTGC
GGCCGCTTCATCGTAGCTCTCGCAGTGCTGGGGGAGAGAAGTGGGTGGACCATAAGCCTT
CCTCCAACATGGACCTGGGTACAGTTCTGCAGCCGGTCATCCCAAACGCCATCCAGGTGT
TCGCACCCAGCGAGAAGGTCCTGTCCAAGTGTGAGAGATTACCGCTGACGCACCAGGAAG
TTGCATCTGATGGCGAGATCGAGACAAAACTCATCAAGGTAACCTCAGAAATTACTTTTT
TTTAAAAAAAATTCTCTTGAAAGAACAGCTTTGGCCTTCACACTTGTCCTTTAGGGGGAT
GTGATCAAAACCAGAAGTGGGGGACAGGCCGTCCAGTTTACCGACATTGAGACGCTGAAA
CAGGAGCTCACCAGTGTTCCCAGGTACCACCCAGCAGCCAGTTCCCAGCAGCAGATGAGC
CAGATGGTTGGAATGATGCATTCTGTCTTTTATATTCACATTTGTTTCTGCAGCCGCAAA
AGAAAGTCGTCAGAGGACAAACCAGCCGGCGGAGATCAGACAGACGGGTCCTGGACCGAC
GTGGAAACGAGGGTAGGTGGATTCTGATCGGTTCAGAGTAGCTGACAGTGGATGAGGGCT
ATCTAATTCAGGTTTCAAAGGCAACATTTGTAACAGTTTTTGTGCTGTTGTAAGAAAAAG
GTGACTTTATAGTGTAACTGTCCTGCTGTTTACAGTGTGCTGTGGCTTTGGAGATGAGGG
CTGGTTCAAACATGGGTCCCAGCTGTGTGATCACCAAGTAAGCCATTATCCCTCCCGCTG
CACATCTACACATGCTCTCCTTTTCATGTAGTTTAGAAAAGAAGACATTTTTCTTTTTTT
TTTCCCCACCCCAGGCGCAGAAAACCCTGAAAACGGGCGGAGACTCCAGACCATATTGTC
CTTACCTGTCCTCATCGTCCTCACCTGGCTGCTGTGCACTAGTCTCAACTTTAAAAAAAA
AAATTTTTTTTCGTACTATTTAAATATTTTCACTACTTTTATATATGCAAGAGAGTATAA
AAAAATGACCACCAAAGCTGCTTTATAAAGTATTTTACCATATATGTCCTGTTTGAGTCA
ACAGCGGTAGCGAAAGGTTTAGTGGTGGTTTAAGCGAACCTGCACATTTTACTGTAACAA
TGATCACATTTGTTGCTCAGCACACAAAATCATGTAAACTGGCATTTTATAACGCCATTT
TATTACACTCTTTCCCCACCTTATGTCGTTTCTGTGTGTTTTTGGCGACTCAAACGCTTG
AGAGCAGCATTGGACGTGCCCTGAAGTGACTTATCGGTACCGCTAGGTGGCGGCAGCAGC
ATTCGCAACACTGATGTCCAGGAATATTAGCGGGAAAGACCAGTGATTCTCAGTTGCAGT
TTTCTTTTAAATGCACTCTTACCGACAGGACCAGCGAGTGAGCTCTGAAAGCTGCAGCAG
AACAACAGCGTCGTGGCGCGTGGGCCTTGGTTATCGGCCAGGCGTCACCGCCTTAATGAC
CTGCTGAAGCCGGCGTGCTGCACTCATTCGGCCGTTTCAGTGGATGCCGAAAGCTCATCT
ACCGTCGGCCTGGCTGAGTTTCAATTGGAACGTGCTGGAGAGTGACTAACGCGGAGCCTC
TCGGAGAGGGTCAAGAGCGGAGAGCGACCGATGGCCATTAAATTTACTCCTGTGAGATAT
GGAGTGCTTTGCTTTTTGACCAGGCGCCGTTTGATGTGCAGCGCCACGCTATTATTCCCT
GCTCCACACCGCAGGACCCCCACCGGCGAGTGCTGCCGTGTTATAAAGACATTATTCCGA
AGCTGCTCACGAGCAAACATCAGCAGGACAACATTAACAAAAGCCCTCACAGGCCTGCAA
CAATGATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1177..1243, 1437..1566, 1778..1883, 1957..2093, 2169..2281, 2368..2535, 3017..3129, 3377..3498, 3598..3700, 3779..3858, 3932..4051, 4124..4283, 4404..4565, 4650..4816, 4920..5094, 5170..5373, 5444..5677, 5754..5842, 5933..6011, 6155..6216, 6305..6329
1001..1014, 1177..1243, 1437..1566, 1778..1883, 1957..2093, 2169..2281, 2368..2535, 3017..3129, 3377..3498, 3598..3700, 3779..3858, 3932..4051, 4124..4283, 4404..4565, 4650..4816, 4920..5094, 5170..5373, 5444..5677, 5754..5842, 5933..6011, 6155..6216, 6305..6329
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved