Tetraodon_nigroviridis Locus rpl4
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl4
Tetraodon_nigroviridis
rpl4
13
SNORD16, SNORD16, SNORD18, SNORD18
2054..2153, 2432..2531, 3215..3285, 3479..3546
4934
aataaagacacagcaaaattattacttacagctttttcacaaacgtgaacgggctgatt
tgcacagtgcatatttatcactggtatttggtcacccttcatttttaatatttgaatgtc
ctcctaaacccaacagagaagacagtgacattattatagtacagattcgatggcagtgat
gatgatcatttgttttaaatacaattacctcaagtataacgttacaaggattgctgcctt
cctccccatcttgtaaagacctttagtgcaaagcatttgacaatagtaattaataacttt
aacattatagtaaattgttactggttagcagacgacaagcgcataatcaacaacaaacat
cgagatgatttaaaagttagccgagaaggctatgaggttaggagaagcaatcgtgaatca
acttaccgtaaaagattgtaaaacgtcttggccctggatataactttagagcccattgag
aaacgtcccacgttaaatctccttaacgcgaaaagatattatgggaaaatatataaatta
tgtttgacgcacacatataatgtttaggctgctgctgtggttatttgacagtcgcgcgcc
cagtgctgacgtcaaaaggtcatagttcaatcttttttataaaaactttacaaggcatgt
ctataactgtaaatgtttttatatatgtatacaaagaaaagacatttttacaaaacaata
tacatatttaaaaatatatatttagagaaaatcggtttttgatgtagtgccgtcatccgc
caacatggcgtaaagaaatagttccatttacaacaaaaaacttttcatatttaaaaatcg
taaaatgatctggaatcgcgtgttattatttttatacatgctttatattttttttcaagt
ttgttattttacagtaggtaaaacataagtaggaaaacattgtaccgccggaaaaggtat
tcgacctgcggaggcataaaccatttagggtgcttagctaacttcctttttactgtggcc
gccatagcgagtggagcgtggtcccggcgagccgaaacataactaccgaaaatggtaaag
atttttcctattattattatttacaacatacttaaatatatatgtagcaaggatttttat
atatccttcacaactatgcaaggtttgtagtcttacgggcgcttaagaatgaattaggtg
tagctgagggctggaactgccccggctagcgaagctaacacacggagccattttgaacga
ggcgctttagacttacacgtgtcttaagattcagtgctaagtagtaaaaagtcatctttg
gtgataccctcctatgcgctctttgtttgtgttataacacatgtatgagcctgccgttgc
aatcacactagattaaagataacgtgacattttacctagcaaagctgtgcgtgttagcga
agtcaagctaaggccagcagctgcagtcataagagctgtctgttacagtcgctttgaacg
acaaaactgtgacaatctctttaattggaaatgcatttttgacgtggatttgtacctaaa
tgataaggctaatgagttctctcatttgtttgTAGGCCTGTGCCCGACCCCTGATCTCGG
TTTACACCGAGAAAGGAGAATCTACAGGCAAAAATGTTGTCATGCCCGCTGTATTCAAGG
CCCCAATTCGCCCTGATGTTGTGAATTTTGTTCACACCAACATGCGCAAGAACAACCGCC
AGCCTTATGCAGTCAGTGAACTGGCAGgtgagtccatccattcagacatttgtttgttag
acgtaagtggcccatttcccccctcttcaaacaggttctcagatttgacggaggtgtata
tttgtttcagGTCACCAGACCAGTGCAGAGTCTTGGGGTACCGGAAGAGCTGTTGCTCGT
ATCCCTCGTGTTAGAGGTGGTGGTACTCATCGCTCTGGCCAGGGTGCTTTTGGAAATgta
tccttttgacccagttcaaaattttaattccaacttgttgaagctatgctatttggatca
atgcagtaaaaacttgcactgatggtgtaatttgcgtctgactctgtgaccggtgacagt
tgcctgctgtcaatatgctggcacatacgactgacgagcaacagtgtctgagcaggtaca
gtatatttcaggacctacacccacagcctggttggatctccttgacttcactctagATGT
GTCGCGGAGGTCGCATGTTTGCCCCCACCAAAACCTGGCGCCGCTGGCACCGCAGGATCA
ACACGACCCAGAAACGCTATGCCATCTGCTCTGCTGTGGCTGCGTCTGCCATTCCTGCTC
TTGTGATGTCTAAGGgtaagctctcagtttgcgaggcgttacgagatgtatgtaattaaa
ggtctttatagcaagccttttaccgtgtagcctgccatgatggtgtaatttgcgtctgat
cctgtgaacgctgacagttgcctgctgtctctatgctgtcataggtagttgatgtatgct
aaggtctgagcaagcattagtgcttgtctttaaaaagtttgaaggtgtgcatgtgttgac
caatactttgaatatatttgttttagGGCACCGCATTGAAGAAATCCCAGAGGTTCCACT
GGTGGTTGAAGACAAAGTTGAGGGCTACAAGAAGACTAAGGAGGCTGTTCTGCTGCTGAA
AAAGCTCAAAGCCTGGAATGACATTAAGAAGgtacggtggctactcattatgattgctgt
tagtgtgctgataagtgtattaaagtgagttgtgggtttagGTCTACGCCTCTCAGCGCA
TGCGTGCTGGTAAGGGTAAAATGAGGAATCGCAGACGCATCCAACGCAGAGGACCGTGTA
TCATCTACAACCAGGACGCCGGTGTCACCAAAGCCTTCAGAAATATCCCAGgtgacctaa
atccgtcgatgtgaaagattcttttaagacaggaactaaagccttaacctttttgttttg
ctctattttgaagGCATCACTCTACAGAACGTGAACAAAATGAATCTGCTGAGACTTGCT
TCCTGGTGGCCATGTTGGACGCTTCTGCATCTGGACAGAGAGTGCCTTCCGTAAGCTGGA
CGATATTTACGGCACCTGGCGTAAACCTTCTACCCAGAAGGTTGACTACAAgtaggtgta
gaaatttaacatcaacaccagtctaaatcttctgatttcagtgatgatcttctacttcag
gtccgtgtttttgaaacagtgtgatattcatcgaagttctgagttctgagtcaaacaatc
ttcagtgtttaccagtagttttcccttgagttgaagttttggtttgtcttttccagCCTT
CCCATGCACAAGATGACCAACACTGACCTGAGCAGGATCCTGAAGAGCGAGGAGATCCAG
AAAGCACTTCGTCCACCAAAgtaagtaccactgaagcttcaaagtgtgtttcaacctgtc
gcctatgatgatgttccacttctggtccgtgtttctgagtcctgattgttacggaagttc
tgagcaacactttctttaagcttgtccacctcggtgttagttcacgataataaacccagc
tgatgctgtcgttgcagCAAGAAGATCAAGCGCAGAGTACTGAAGAAGAACCCTCTGAAG
AATTTGAGGATAATGCTCAAACTGAACCCCTATGCCAAGACAGCGAGACGCCATGCCATC
CTCAAGCATAACCCTGAAgtaagagcagcttgaacgggaccttaaagcatcattggcctt
gattgcaacttaaaatatgtcttctctccacagATCAAGGCTAAGATGCTGAAGCCCAAG
AAGAAGCCTAGAAAGAAGGCAGCACCAGCTGAAACCAAGGCATAAaagtactcaacaggg
gttccctgctaaataaatcatttgacttgcataattgagtcacacctcttttattaaaca
tttctgattacacatagatggcaccgggattctgggtacattttaggcacacagagctga
gtttaatcagacgagtacagcctaacctgaatggagcaaaacgcagaagcagagtcgtac
ctacagacagcagtccctgaagcaaatcggggacccttccatgcctcaggacaatagcaa
aatacagtttcagaaacctcccataggaccagaacaaccaaagcaaaaaatccaggaggg
aaataacagaaaatacaaacttggcttgttccaattacacaacagtatatatatatcata
tttttcacactggttaaaatctcacatctggacaacgagtgatttccaactcctgaagca
cacgagcagcgcagcttctaagtgattgcatcgttagaaaaacatggcttttcaagcagg
cctgaggcttaacggcagtagaaagtcccgtagggcttcatcacaattgaaaactgaagc
tttaggaccgtctaaccgttttccgcgtaatgtaattgcagtgatgaccgatagcccgga
ggttcgttagcctcacatcgctgtcccatgggtgggcgtcccaggctgattgaggccgat
ggtgctgcacaaccagccggcaaaatccacctgctctgcctcggaccgtttgatgaaggg
atgcacctgaggaaacagacgtgtgtgatattaaaaagagctgatcaaacggcagagcgc
gcacacctaccatcagctgcttcaggtccgctctctctgctgggttcttgatcaagctgc
agaggaggcacagagcgatgcggtctaaggccactaggtggcagagtttcaccattgacg
agttgggatttctcccacttaccatttattcacaaagtcttgaaattcagcgctaaatat
tgcaggcagcttgggcggaggctgaaaatgtacagaaaaactggtttaagttgtttcttt
ttgtttgtgtgacag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 1595..1766, 1870..1976, 2216..2354, 2606..2730, 2801..2930, 3013..3170, 3356..3439, 3617..3737, 3813..3934
1071..1073, 1595..1766, 1870..1976, 2216..2354, 2606..2730, 2801..2930, 3013..3170, 3356..3439, 3617..3737, 3813..3884
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved