Tetraodon_nigroviridis Locus rps13
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rps13
Tetraodon_nigroviridis
rps13
13
SNORA19
2929..3057
4177
CGACAGCTTGCCTTTGAAATCGACAGAGAGGTGGATGATCAGAACGATTATCTGGACGG
CATGGTGAGGAACGAGCCTCGGTCCTCTGTTACTCTCTGTCCTCTGCTGATGATTGACCC
TCTTCTTTCAGGACTCCAACTTCCTGAGTGCGACGGGTCTGCTGAGCGGCAGCGTGTAAG
CGTTTTTCCACCATGGTGCGGTCTGGCAGGGACAACCGGCGTATTCTGTGTTACGTGTCT
GTGGGGCTGGTCCTGGTCTTCTTTCTGCTCTACTACCTGATCTCCAGGATTCAGCAGTGA
CTTCGGCTCCTCACATCTGCTACAGTGGAGCAGAGTTTTATTCTGTTAGACAGAGAGGAG
GTTCTGAGAGGGGCCTCGTGAGGAGCTGACCGGAGGGACCGACCTGCTGCGACTGATGCG
TGAACCTACCAGCTGTTTGTCTCAGCTAAACTTTTATCACACAAACATTCGTTGCTGAAA
GGCCGGAGGGTGACGTGGTTGCTGTAGCTGACAGCAGCTGTTGGCAGCAGAGATTTGTTT
GTTTAGAAGTTTATTGATCCCGGAGTCGTCACGATGGCATGATGGAAAATACAGTTTCCT
TCATAAAATGTCAAATGTTAAAAAGCTTTTATTTTTATATCTTCACATTCCAAGTGTTGC
AAATTTACCTTCAGGCAACTTTTGTAAAATGATTAATTGATGTAATAAAAGGGTTTAAAA
GGGTACAAAAATATTTTAGGTTATCTATTTTTCTTAGCATTATGACACTGAATCTGTTAA
ATGTTTGTAAATAACATTAGCATGTAAAAAAATTTTAAACTTACTGTATATACTGTATAT
ATATATATGATAAAGTGGAAAAAAGATGACCAAAAAACAGCTCTGTAAATTAGTAACTAA
TTTATTTAGATTAGATTAGAAATGATTCTGTATTTTTGTGCGTCAACAGGTTTTTGTCCG
TTTTTTTCTTTTTACACACGTCACTGACGTACGCGCGTCATCACGTCATTAAACCGGCAT
CGCCGCAAAATTCCATCTTGTGTCTCGTGTGCGGCCTCTCTTCCTCAACCGCCATCATGG
GTCGCATGCACGCTCCGGGGTAAAATCCCTAATCTAATTTTTCCATTAAAAACTATTTAC
TTTCTTTTGTTTTATTTGTATACTCTAAACCATAACGATCCTTCTAAGCGGCGGGGGACA
AAAAAGAATTTATTTTAATCACCAGTGAAGATATATTAACGTTAAACAGACGCACTCGTA
GCCATCAGGCTGCAACTACTTAGCATTTAATGCTAGCTAGCTAACCGCGTTTTAGATGCT
AGTCTGTATTTTTGACATTCTGCAATTTACTTAACGCTTAATACAGTAATAACTTAAGTA
TATGTTTTTTTTCTTTTCCTTAAACACTGAGGACTTTGTGTCACTCGATACAGTAGATAC
GAGGAATGGTGTGACGACCGCTGGCCTGTCCTCGCATCGGTGTATTGTGTTCAGAGTAGC
GATTTTATGACGACGTTTGTAACCGTGAGGCCGTTTCTTTCCACAGAAAGGGTTTATCCC
AGTCAGCTCTGCCGTACCGACGCAGTGTTCCCACCGTGAGTATCCTCCGCCTGCAGCGGC
CAGCATCAGCCGCTAGCGGCTAGCGGCTAGCAGCAGCTAGCCTCTCTGACTGTGACTGTC
TGGATTTCAGTGGCTGAAACTCACCTCTGATGATGTCAAAGAGCAGATTTTCAAGCTGGC
CAAGAAAGGTCTGACCCCCTCTCAGATTGGTGAGTACTTTTAAAACAGGAGAAAGTGACA
TTAGTGCCACCTTTTTGCGCAACATCTCTGCTGCTGGTATAATTATTGTCAGTCCTTAGT
GTTGTAGCAAACATTTAGTTGGTGGTTTTGATCATGTATAAAAGTTAAAATAACAATCCA
ACTGTAATGCTTCTCTGTGTGTGAAGTGTAAATTGTCTGCGCCTGTCCACGGTTTTGTTC
CAGTATTTTTCCTGTGAGAATCTTCTTAATTCTTAATTCAAATGTCAGTGTCTGCAGGAA
CTCAAACAATAATGTACCTATTGGTCACTAATGTTGGATTATTAGTTTGATTTTGCTTGT
ACTGATGATGTTGGATGATGAGACTAGTGGAACTAGATGGTGCTGAACCAGCAACATCCT
GGTCTCTAGTTTTTACTGAACAATATGTGATGACTGTTTTTACATCACGACGGCACCAAC
AACAGCTTCTGTCCTCATCCAGATTGCAGAGAACAAATGCATCCCTCCCACCATGGTTTC
TGTTGTGGTTCTGGTTTATTTTTGTTTCACACATGTAAAAAAAAACCGTTTAAACCTTTG
ATTCTGAGGTGTGCAGAATTCCTGAATGTGGAAGTTTGTTTCCCCTGACAGGTGTGATCC
TGAGGGACTCCCACGGTGTTGCCCAGGTACGTTTTGTCACCGGCAACAAGATCCTGAGGA
TCCTGAAGTCCAAAGGTCTGGCCCCAGACCTGCCCGAGGACCTGTACCACCTGATCAAGA
AGGCCGTGGCCGTCAGGAAGCACTTGGAGAGGAACAGGAAGGTACCGCAGAACGGATGCT
TTCCAGTCATGTTGGGCTTTGTTTCAGGACTTTGTTGATTTGCTGAGCCGGTCCCGTTAG
AATATGTAACCTTGTGGACTGTTTGAATGAAACATGGGCAGCGTCTGTGGAGGTGGCGCT
TTCAAGAAGGCCCGCCCCTTCCTCTGAATCATTTAGTGCTTTATAGCCCGAAACCTAATT
CTCCCGGTCAAAGACGGACCTTTTCAACGTTGTTTTTGTGCAGGATAAGGACGCCAAGTT
CCGCCTGATTCTCATTGAGAGCAGGATCCACAGGCTGGCCCGGTACTACAAGACCAAGAG
AGTCCTGGCCCCCAACTGGAAGTAGTACGTTGCCTTTCTTCGCTTTCACGGGCACAGTTC
ATTGTCCGGCTCCGCTGTCCGTCGGGGCTGCGATATTTCTGATGTGCTAGAACGAGCTGG
AGGTTAATTAGCAGAGCGGCTGCTGGGTGCCTCGTCTGCCAGTCCCCTTCACACACTGAC
AGCAGGCCCGCCTCCGTCCGGCTGCTAACCCTCTGCTCTCTGTCTCCACAGCGAGTCCTC
TACAGCATCTGCTCTGGTGGCATAAACTTCACTTTTTGGATTAATAAAATACTAAATGCT
CATCAGGCCTTTTCGCTTTCATTCCTGTGAAGCCGGTTCCCCGAGGAAAGCCCGGGTTGC
TTCCGGTTGCTCGGCCCGTCTCTCACGCGTCAGAGTGACGTTTCGGAGGTGGGCGTGGTC
ACGGCTGCACTCAGCCAGTCACAGCTCGCTGTTCCCGTGACGTGAGGGCGCTTCGCGATT
GGCTGACTTCCGCCAATCACAGCGCACAGAGACGTATATAGAAGTTGCCGTGGCACGAGC
CAAACAAACCGCTTCGACACAACAGGAAACAAAGATGGAGGCCGGACGCGAGCACCAGTG
ACCCAGAGGCGCCCAATGGCCCCCAGCCGCGACAACATGAACCCGCTTCTGTCGCCGACC
ACTACGCGAAATCTACCGCTGTTGGACGAGGAGTACCAGAACACGTGAGCGGCGTTGCGA
AGACCCCGAGATGGCTCCGAGCGTTGGTTCCGAGGGCTCGGAACGGGCGGACATGGCGAG
GGTCCGGCCCGGAGGCCTGGCGCTGCTGCCCTGGACCCGGCAGATGCTGACGGTGCTGTG
GGCGCAGATCCGCCTGCTGCTGCAGGTCATCTACTACAGCTGCATGTCCGGTAGGGCCTC
CATTAGAAAGGCCCGCCTTGAGGGCTTTATTCACATTTATGTTTCTATTATCGATTTAAA
TGCTGATGTAGCTAATCCCAAAGATCAAAGCAGCTTTGTTTCCGAACACTACTATATGAG
GACCTGTTAGTTTTAAAAAAAAACCATTTTAACTGTTGTCTTTCAGTCTGCGGGTTTACT
CGCCCTTATTTGTTGTAATTCTTGAGTGTTTTTGGGAGTGTGTGTAGGTTGTCTTAGATC
TTGTCTTTTATCTTGTCTTTTATCTGGGGTCACCGGCTCTTGCTGCTTGTTCCTCTCGGC
TACAAACACTATAAACTAGATGTTATTATTACTCTGACTTAAAAACATGGATTCTAAATT
AGCCAAAGTCGATCGACCAGTTTTTAACGTCCTGCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1098, 1546..1594, 1690..1768, 2391..2560, 2803..2903, 3111..3177
1076..1098, 1546..1594, 1690..1768, 2391..2560, 2803..2903, 3111..3144
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved