Tetraodon_nigroviridis Locus zgc:114188
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis zgc:114188
Tetraodon_nigroviridis
zgc:114188
13
SNORA71, SNORA71, SNORA71
1870..1992, 2384..2510, 3418..3544
4723
ACTTTTGCTGAAGCGGGTCAGCAGCCATGTCTGTCTCACAGGAAACTATGGCCACGAGT
TCCCTGGACGCCCGACCGGGACTCCTGGCTATCAGGTTTACCTTTAGGACCTCGTGGAGC
ACAAAACCGTTGACGTTTTATCCAGGGCCGTGAGAGAATGGAGATAACGTCCGCTAACTT
GACATCAAACAGGTTTTTAGTGAGCCTAAAGTCAGAACTGCCGGTTTAGTTCAAACCCAA
GAGGGTGGACGTGAGCGTTGTCCAGTTTCTGCATGTAAAATATAAACAAAGCTGATTGTT
TTCTGCATTTACTGCGGCCGAGGCCTCGTGAGACCATGAAATGTTTATTCTCATACAATT
ACCAAAAAGCTTGAATGTATTCTGACTCGTGGATAAGTTAAGAGCACAACGGAATTTTGT
TTTAATAGTGTTTAATCAATCGTTTGATTGCTAATAGTTTTTAGAAAAAAATCATTGCAT
TAAATTATTGATTGTATTTTTCCACATTGCTGTATGATACTCTGAGCATCCTGTCATGTT
TGAAACGTTAATAATTTCATATGATTATGATCATCTTAGAAGAATAGTATATTTCTACGG
TTATGTGACTCAACAGACAGCAAAAGAATGAAATCTGCGTTTTTATAACATTTGGTCTCT
GACTAAGGGTGTCCTCAAAATGAATCTAAAGCATTATGAAACTTTATGGGTCTCAGTTCG
TTTGTAAGGGAAATCCAATCATGTTTGTATGTAATAAAGTTTAAATCACATGAAGTCGAT
TTTAGTTCAGGTGATGAAATTGTTCCTACCAAGAAAACAATTATTCTACGACGAATCTTT
TTGCGATGAACGTTTTCTGATCTAATTGTGTTTTCCCCCTCGGAGACACGTTTTTTGACA
CCACCTTCGGCGGTTTCGATGTTTTCTGCGGCGGGAGGCGTCGCTGCAGTTCCGGCCTCC
GGCCGCCAGGCGGCGGACTGTGGCGCTGTTGTCCGGCAGTGGATTTAGGCTTCCGCCGAC
AGCCTGCTTGTTCTCTTCTACCAGGCCGATCCAACATGGTGGGTAGTTTTTCCATGTCAA
CTTCACCTATCTAACGCAATCCTCACTAATAAACGGTTCATTGTCCGCCACAATGCCATC
CGCGGCCATCTGGTCAATTCAGACAGTTAATCATCTAAATATTAGTAGTTGATGAAACGT
TGGGAACGCCGTATTCATCGCGATGTCGGAGAGAAATTGAGCTAGCCGATGTAGCGGTTC
TTAGCTTCTGTCTGACTGAAAGAGGCAAAGATTTTACCCCTGATTTACTAGCAAAGAACG
ACGATAGCGACAAAATGATTCTGTAATTATGTGCATCTTTATTCGGAAGCAGAACAGGGT
TTTGAATGGCCAAGTCTTCCTAGTTAGCCCTTGTAAATACACCGGTTAGCTTCTCAAAGG
GAGCATAGCTAGCAAGTGGTTGCTGGGACCTGTTCCCAAGCCGAGGGCTGTTTTATTCAC
TCTTCTGTGTTTTGCTTCGCTGTGGTCGATGACAGTGATATTGCTGCACGACTGGCTTTT
AAATGGGTTTGTTGTGGAACTGGTTGTGACGTGGGATTGTGTCTTTTTACGGTCTTTGCT
GTCGTTTACTGTCACATGGCTTCATGTCGTTCCTTTAATGCTTAAATAAAACTGTTTCCA
GGGACGAGTCAGGACCAAGACGGTGAAGAAGGCCGCTAGGGTCATCATTGAGAAATATTA
CACCCGGCTGGGCAGCGACTTCCACACCAACAAGAGGGTGTGTGAGGAGATCGCCATCAT
CCCCAGCAAGAAGCTTCGCAACAAGATCGCCGGGTGAGTCTGTGGGCCACACACCCAGAG
CCCAGTCCTGACCTGTATCGAAAGTGATCATGGTAACCTTGTAGCCAGGTCATCGATAGT
ACAGGAAGAGCAACCAGAGAGCTTTTCCCGTGTTTGTGGGACTGTTCCCATCAAACCCTG
GCGCTCTCATACACCCGCTAAGCCTGCTCCTTTAAGCTCCTTTTATTCATGTTCCACATC
GAGGGCTGCAAGTTAAACGTGTCTTTTGCAGGTATGTGACACATTTGATGAAGAGGATCC
AGAGGGGTCCAGTCAGAGGAATCTCCATCAAACTGCAGGAGGAGGAGAGGGAGAGGAGGG
ACAACTACGTTCCAGAGGTCAGAACTCGCTGAAACCCCCGCTGGCGCTTTAGCCTCAGCG
TGGAGCTGATGTGTTGAACCTTGTTGTCGTCCTGATCCTGGACGTTGTGATGCTGTGGTT
GGGTGTATTTCTGGCCTCTTGCTCGTTGGCTGCGGATGTTGTTGTTTTCCGGTATCGAGT
CATTTCTTTGTCTCGTTGCGTACTGTTCACGCTGCTGCTGTGTCTCCTGTATCGAAAGTG
GTCATGGCGTCGTTGTTGCCAGGTCATTGATAGTACAGGAAGAACACCCTGTGAGCCTTT
CCCGTGTTTGAAGGCCTGAACGTTCCTCTCAGACCCTGATGCTCTCAGACAAGAAAATGT
TTTTAAAATGCTTCTAATGATGCGTTAACGTGTTTGGATTGACAAACATCTGGACAACTT
TCCAAATATTGGGTGTAATGTCCCTTTTTGTTGGAGAAATTGTAATATCCTCAATAAATA
ATGTAGTAAATTTATTCTGAAATATTTTAAAGATTAACATCAGCATGATGCGACATTTTA
TTCACCCACAGGGCACTGTTGATGGTATGAACGCTATCTTTAGTTTTAGTGTTTGTAATG
TTAAGATGTATTGAAATTAAGTTCTAGCCATTATGTCATCAAACATTTTACCATAGTTTA
TGCTGTTTAAAGTAGTTCAAAGTCCTTTTTGAACAGTCTGAAAGCAAGTGTGTCGTCTTT
GCCGGCAGGTTTCTGCTCTGGACCAGGAGCTCATTGAAGTTGATCCCGACACCAAGGAGA
TGCTGAAGCTGCTGGTGAGTTTAGTTTACCCGTCTGGTGACTGCCGCTGCCGCGCTGGTG
TTTAACTGGAAAAGGCTTCTAGACGATTTCACCCAAGATGGGGGATCTACAGACCTGTAA
AACCTCCACCTCACAGGTGTTAAAACCTGGCTAATGTTGACGCCAAAATCACCTTCGCTG
CAGCCGCTGCTGAGGGTAATCTGATGGAGTGAGTGGCTGCTGCCTTCAGCCCTACCTGAG
CTGAAAGGTGGAGCGGCAGCAGAGTCGATGAACCACCCGGAGAGCTGCTGAAAGGTTTGT
TGATGCAGGAAGCCGAGGTTAACCCCAATTCAGCAGGCGGTTCCTCTGCGGAAGAACGTC
TCCTAGACGTGTCCTCGGTGCGTCTGTGCTCTTGTTTGACACTTTGGTTTAGGGCTGGAA
CAGTGTTTGTGCAGCTCTGTCTCCGTTTAGCGTGGAACGCGTCGGCGCTCCGCCCCCAAC
CTGTATCGAAAGTGATCATGGCGTGCTGGTTGCCAGGTCATCGATAGTGCAGGAAGAGCA
ACGTGCGAGCCTTTCCCGTGTTTGCAGGAGCGTGCGTTCCTCTCAGACCCTGGTGCTCTC
ACACACTCCTCCCTCCCAGGGTCATTCTGTCGAGCGCTGAGAGCCGGTTTTGTGTCTTGC
AGGACTTTGGCAGTCTGTCCAACCTGCAGGTCACCCAACCCACCGTCGGCATGAACTTCA
GGACACCCAGAGGAGTCTAGACATCCGTAACCTTTTCTTCCAAATAAAATCTTTGGGACA
AATGTGCTGCTTCAAAGTCGTTTTCTGTGCATCATCCACGTCTTTGTGTCGCAAAATTTA
CAGAGAAACGGAGTCTGGGGTGCGATAGTTCAAGGCAGCAGATTAACGGGAAGCAGGATT
AACACACGTTCATCTGACGCCTTTTGACACTAAATCATCTGTAGTCATGGTAACGTGTGA
CGGTACGGCGGCGAGACACTGAAGGTGACCTGGGATTTTATTGATTAACACTATTTTACA
GTTGGACTGACAGAAGTAAAACATTTATATTTACACCAACGAGCACTTTTAAACTACTGT
GGAGTATTGTTGTCTGTGAAACAAGTGGCTCATAAGCACTTCAGCAGGATGATGTTGCAG
AGGGCCCCTCGAGGACAGTCGCACATCTTTCCGATGCGAGAGCCTTTTCTGATGGCACAG
TGTTCCCCGAGGTCGCACTGGAAGGTCCCACAGGTGTGGTTAACGACAGGAAGTGTGCAG
GTGTTCGGTGTGTGGGTGGGCGGACTCACAGAGGGGACCTGGCCGTACTTCTTCTCCCAG
GGGTTGATCCTCTTGGTCTGCAGCCTCTCCAGCACTTCATGCAGCGCACCGAGCTAAACA
CACACACACACAATTAGTCTGAAGCTAATAGAACCACACAGCCCCACGAGTGATAATTAA
ATTGATTTACACTTTTTTTGGTTACTGAAGTCATAATGCTAATAATTAGCAACTCTGGGG
CTCGTCATAACACAAACCTCTTTTAGAAAAAACATTACATGTCAAAGCTTGAACTTTCTG
ATAAATATACTGATTTTTTTTTTTTTTAATTATCTGTATAACCGAACTAACAGAGTCATC
ATAAAAACATGTAAAAACCCCAGAGCAGCAGATCTGCATTTTAAATGATAGTTCACCCCG
TACACGGCGCGGCCATCGGGACCCACCAGTCTGCTGGAGCTGGAGTAGCCGGAGTCCTGG
ACGCCTCTCTGCTGCCTCTCGGCTTCCGTCGTCTCCGCCGCGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1681..1832, 2071..2176, 2888..2953, 3602..3723
1055..1057, 1681..1832, 2071..2176, 2888..2953, 3602..3679
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved