Tetraodon_nigroviridis Locus ranbp1
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis ranbp1
Tetraodon_nigroviridis
ranbp1
12
SNORA77
2075..2206
5220
AGCTGCTCGGAAAAGAAGATCGAGACAAAAATCACTATTTAAACAACCTGGCGTAAAAC
TGAAGCGGCCGATTTGGTAGTTAGCTGCAAACCGTGTTTGTATTCATTGGTCAAAAATTG
TACTTGAAATAATTTTGTCTGACGGTTGCTAACTGCTAACGTTAGCTTGAGCGATGTGGC
GCTGGTTCTAAATGCTCAATTTAAATACACGTTAAAATATTTTAAATATTTCTGTAGATC
GCCGAGTTCTCGAATAGGCAACTATTGATTATTTGTGAGTCGTGGTGTAAAAACATAATT
AGGCATCTCTTTGCTAGCCTGATGCTAACAGGCCACGATAACTCGGAGTATTTTCACAAG
TTGTCGATTTACTGAAGAAAGTGCGAGAGATGAACGTTTACTAAATTATGATAATCAAAC
ACTGTGTGTCATACCCTTTCGTGCGTTTTAGATCGCATTCTATTTTCTATAACGTGGCTA
AAGGAGGAGTACAAGCATCACTTGTATGACTTTGCTTTCAAATCTGGCGCAAATGTTTGC
CTTGTGATACAGCCAAGTTGCTAACCAATAATGTAATTGGTAAGCACCATGTACACGGAA
GGTTGGTCTTACCTCAGATTTACATCGGAGAAATCGTGCACTTGTTAGGTGATGACCATA
TGCCCCAGTTCATTTAAAATTGTAGTTTTGAACTTAACAAATTTTGTGTATATTTTTTGT
TTACACCATTGTGTGTGGTTTAAAAAGTCTACCAAAGAGAATGCAGCCTAAAATTGCATT
AAAGATGCTTTGCTCAGCAGCTGAGCGTTACATAAAGCCTTCCCAGTTTTCCCAACAAAA
GCTCTACTTGACCGCTGACCCTCTAAATCCCCCCATTGATGCTCCTCTGACCTGCTGTTC
GGCTGCAAAATGTCAGCGTGTCCCTGTGATTCATTCTGAAAGATTGTGCATATCTAAGTG
TGATTCTCTAAAATGGATGCTCTTTCTTTGAGCGAACTCAACGAGTGTTCGTGCGTTTGC
AGGAGCAGGAACAGGACGACCACGACTCCACTGCTGAGGACGCCAATCATGACCCCCACT
ACGAACCCATCGTGTCTCTGCCTGAGCAGGATGTTAAAACATTAGAAGAGGACGAGGAGG
AACTTTTTAAAATGTAAGTTGCTTGAGTTTGCTGCCCAGCGCGGGGCCGCCTGCCCATCT
CACCATCGAGCTGCTTCCTCCCGTGACACACAGGCGAGCGAAACTGTATCGTTTTGCATC
TGAGAACGACCCACCGGAGTGGAAGGAGCGAGGCACCGGTGACGTGAAGCTGCTGAAACA
CAAAGAGAAGGGAACCATCCGGGTCCTGATGAGGAGAGACAAAACCCTGAAGATCTGTGC
CAATCATCACAGTGAGTCCCGATCCATGGCTTTCAATTTCCGAAGTTAAAACGTGACATC
CAGAAGCAGGTGTCGGTGACGTTGTGTGGCGTTATATCCGATGAAATACATCTGCAAACA
GCTAACTTTTGGTGTGTTGGTGATGAGCAGTGAACATCAGGTGAGACACTGAGAAAGAAG
TGTGAGGTAATTAACGCAGTGAGGCGGGAAAGTGTGAATCCACATTTGTGTGTTTATGCC
GTTTCTTGTCTCGTGGCCTTCAGTTACACCTGCAATGGATCTGAGACCCAACGCTGGCAG
CGACAGAGCGTGGGTGTGGAACACACTAGCAGACTACGCTGATGAGTGCCCCAAGGCCGA
ATCCCTCGCCATACGCTTTTTAAACGCAGAAAGTAAGTATCCGTTTTAGGGGAGCGCGCA
GCACCCTTTCCAGTTTGCCTGTGCGGCAGGAATTATGAGCCTGATGACTTTGCTCTCATT
TGTTTTTTTAAAAGATGCTCAGAAATTCAAGGTGAAGTTTGAGGAGTGCAGGGAGGAAGT
GAAGAAAATCCAACAGAAAAAAGGTGGGTGAAGTTCTACACACAAGATTTCCCTTTGGAT
TCTTGGATTCGGAATCCCGAATCCCTGCGGTTACCTTTTCGAGCGTTCCACAGCTCCGGC
CGGGCAGGTTCTTCTTCAGTGGTAGTTTGGTGCACGCAGGCTCACTCTGTTCCTGGCTGC
TCGCTCCAGCCTGGGACTTTTTTCGCCTGCTATAGGAACATGCAGAATGTTCACTTTTCC
ACGCTTACCAACATTAAGCGGTGGGTAATGTGTTCTGCAACATCAGCGAGAGACATTCCT
GGAAATGACAGACGTGGCAGCATTTGTTACGAAATTCGTTAGCGGACACAGGTGTGTGTG
GCTCACCCAGATGGATTATGGGGAAAGGAGTGTCCCACGTAGGGCTTTGATCTGGGCTTT
TATCTGGGTATGACCGGCTCGCTGCTGCAAAAAGTATATTAAACTAGACCGCCTTACACT
CGGAGTCATGATTACTTTGAAAGTAAAGAGGACAAAAAGTGATGATTTAACAAAATGTGC
TGGTTCGAAGATGGAGGGAACGGTGGACAATCTAACCTTCTGTCTTTGTGGCCACAGACG
ACCCCGAGAGTGCGAACACGGTTGCAGAGAAGCTGGAGGACCTGACGGTAAACGACAAGG
CTTCAGAAGAAAAGGAGGAAAAAAAGGAGACTGAGGAAAAACAAGATGAGAAACAGGAGG
TGAAGGCCGAGGAGAAAAATTGAGAACCAACTTGCTTTGCTGATCTTCAGTTTAAGAAAA
TGTCCCCTTTTTCTACAATAGACTGTAAATGAACTGAACTTAAACACTTGCATATTAGGT
TTGTTGTTTTTTTTTTTTATCGGTTTTGCCTCAAGACCGCAAGTTTGTGATGCCACAGTG
GGAAAAACGATAACATAGATAAACGACAAAAAGAAGCCCCCCCCCCTCGCCCTTGTCTGC
CATGGAACGCCATGCTCTAAAACACGTCATCTACAGGTCAACGTTGCAAACTGTGAAAAG
AGGCTTGTGGTAGTGATCATCTCCACCTTGGGCTTATTTTCTGTTGTTATTCTAAAGTAA
TTTTTGTTGTAGGAAAATAACCCAGCCTGCTAGTTAGCACAGAGCTCAGTCCTGTTTAAC
TATGAAATCCCATGAGCACCTCCTCGTACACTGTACCCGTTTCCACGCTTATGGCAGTAA
AGTCATGCCCACCCTGTGGAACCCCTCCAGTTTTCCTTTTGGCCAGTTTTCCAAGTTCTG
GATGAACAGTAGAGGCGGCTAAACGTAGACTGACGAACTACCGACGAGCGATCGACCGCT
GATCAGCTACACTTAGTGGGAAGCATTTCTGGAGTTCAGTGCTGCTTTGGCTCAAGAGTG
TTGAATATTTGTCCATTTTAATTGTAACATTCCCAGATTTCCATCATGTAGAGAATAAGA
AAGCGCTCACCCCCTTCCTCCACTGACAGTTGTTCACCTCCAGGGGGCGCACCGAAGCAC
CAGAGCATCTGTAAATACATGTATGGATGAAATGTTGCTTTTCATTTGCACTCGGATTTA
AATTGTTTCCTCCACCTTCCAATAAAAACTGTCAAAGACAGCGTCACTGGTGAAACTCGT
TTGTGTCCTCGGCGTACCGAAAAAACCAGTCTCACTCACAGTTGGAAACTTTTTATTCTT
TATATTCAGGTCATTTGGGAAATATTTCCTCTTCACAAAAATAGGAACGCGTGTACATTT
ATAGAATATTCTATATTTGGAGCCGCGGCTCGGCTCTTGGCTGATGGGGCAGACTCGAGT
CCATCCCGAGAGAGAGAGCACTGGATTTATGGCAGTCGTTAGGAGGAATGACATCGATCG
CCGCCTGGAAGTGGGTGATGGGCTGGGGTGTTTCCAGGCGGTAAACGTGGGTCGCTTGAA
TGGGGGGAAAAAAGCTTCAAGATGCTAGTTTGAAAACTGTGACGTCCTTTAAAGTAAGAT
TTAAACAATCGCACAAATCAAGTGCTGCAGCCCTGTTGTTCAGCTGTTGATATTAAGGCA
GCCGAGTGAGAAACCGCACAAGCTGGACCAGCCTTTGGGCCGGCGTTCCAGGATTTAGGA
GGGAAAACAATGACCTTTGACATTTGCCTCTGCCGCAGCTTGACCACGTGACTGCCCCGT
CAAGCGCACGAGCGCGTCGCGCACGTTTCATCGCTTCGCCGAGCTCTTCCCCTCAAGGCA
ACGGTGGTTTCGTGCAGCTGAATCACATTCCAGACACGTGAAATAGAAAAAAAAGGATCA
ACTCAAAAGCAACAAGGGGAAAAAGTCACAATGAAGCTGTACCAGACAGCTGCTCCGCTT
TGAATTTGAAACCTCAGGGGCCGATTTGAGCACTACGCTGTGGCCGCTGTCCAGTCAAAG
GACACTGCGAGGTAGAACCCTTCAAACCCAGCAGGTCCCCAAAAACGCACCTCACTGGAT
GTTTAAAAGCAATATCGCCCACTTTTCGGACAAAAAAACACAAAACCACGTAGAACAATG
ACTTCCTTCACACTGTTTATGCACTAAACAGCCGACATTGTGAGCGTAGATGCGGGTGTG
GGCTTTTAGAAGACGTCTTTGAGGACCTTTGAGTGTCTGACGTCACTGAAATTAGCAGAA
ATTCCAATTTGTACTAGTGTGTGTGTTGACCGGATTCGTTCCTGAGGAGAGGATGTTTTC
CCACAGAGGTCGGCTTCCGCTTTTGGGTGCGCGACGCCTCCGTCTGTGACGATGGGAACG
ACGCGCAGTCAGACCACAGCGAGGACACGATTGGCGACCGGTAGCCGCGGGACAGTCCGT
CGACGCCGCCGTCGCAAAACGTTAAAGACGAGACGCCGCTCACGCATAAAGTCTGTCACG
GTATCGATCGAAGCTTCCAGCACGGACACACACGGGAGGCGGGAGCATCCTTTGACTCCA
AAACAGAAAGTGCTCCTAGGAGGCTGTTTCCTAGGCAACAGCGAAAAGCCAATCTCTCTG
CAGCGTCCCGGCCGATGCCGTTAAACACGGCGGTCCCTGCTCACACCGATATTTCATACG
TAGTGCCTCCAACGCCCGTCACCTTTTTGACGTTACCGTGGCGACTGGGACTGAGGTTGG
CACCATGGGCGCTGGGGTGGCAGTCCATCTGCCCGTTTACCTTCATGGCTTCTCTGTGAG
GGGAGAGGAGGATGGAGAACGTTACCCAACAGGAAGAGTGAGAAGTGACCAAAAAATACT
GCTGGACATGCAGTTAGTGTGGAAGAGAAAAGAGAGGAAAACGATCGACGATGTGATGGG
A
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1152, 1233..1390, 1643..1771, 1874..1942, 2511..2576, 4171..4220
1001..1152, 1233..1390, 1643..1771, 1874..1942, 2511..2576, 4171..4220
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved