Tetraodon_nigroviridis Locus gnl3
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis gnl3
Tetraodon_nigroviridis
gnl3
11
SNORA47
2359..2492
5317
AGGATGCTAACGCGCTAGCTGCTCCACAACAAGGGCAGCTATCGGCAAGTAGCTCGTTA
ACAGCTAAAGTTGGCTTGTCGTGAAGTACGGCAACGTCGTTTTGACAAGATATGTTGTCG
CTTTCCTCGGTGTTTATATTTTGCGCGAAACAGACGCGGCTGATGGGACGCGTAGGACGC
AAGAGTGCAGTTAGCTTTGAGAGTAGCTAACCTGGCCATATTTCAATCCCAGCGTCTCGC
AGCTTGCGTCTCAGATGGTCGTTCTCCCGCTCTCGGATGGCTATCTCCTCCTGGTACTCT
AAAATTGTATCCTCCACGGATTTGTAGATCTCCTGTGCGGCAAGCATGAGGCGCTCGGTC
AAAAAGACGTTTAAAAACTGCAGTTTGGTCATTTTGTTGGGTTGCGCGGAGACCCTGCTA
CAATCCAAAATGGACCAAAAGATGCTCAGCCCGGTCACGTGACCGGGAGTTGTTTCTTCT
CGTGCCTCTGTTTTTGCCTCGAGGCCCGTCGGCCTCCCGTCACCTCCTGACACGGCGCTG
GCATAAATAAACCCCTCGGTCTGCCTAAAATAGCGGTTTTAGGTGGATGGATCTAAAGTA
GAAGCCAATCGCCAAATATAGTTCAACTTAGATGAGAAAAACACTTACTTTCACAAAATT
TAACACGTAAAACTTTGCGATGGTTTTATGCAAAGGTCAAAAAACCCTGCACTATGCAAA
GGATTGTGTCGCACTGTATTTATAAATAGGTGTAAAAATTTTAAAATGTTGCGAATATAA
TTTTTTTTTACATTTGAGTCCAATATCGAAGTTTGGAAATGATGTCTAATTTATATCTTG
GCATGTCTTTATTTCACTCACTGACCCCTCCTATTCAGCAGGGGGCGCAATAACAGGTGC
CCTAAGCGGAAGTAATGATACGTCATATCCTGTTGCTCACCACGTGTGACAGTAGGGACA
CACACTAGTCTGCCTACTCTACTATTATCTACATCTTCAAAATGAAGCGTCCAAGTAAGT
TACTTTGCAGTCTTTTTGTAGAATGTCGGGTTACAAGCACTCTGATAGGCCATGAAATTT
TATCGACCGCTTATTCGAGCGAGCCGCACAGATGTTTTTATCAAGTATCCGTGGTTTCTT
TTCTATTTAGGCTTAACTAAATGTTGAACACATGCTCAATAAACGTTTGTTCAACTTTGT
TTTTAGAATTGAGGAAAGCCAGTAAGCGGGTGTCATGTTCGAAACGTTATAAGATCCAGA
AAAAGGTAAAGTTGTTTTTAAACAGTTTACAACGTTATGACGGACGAGGCCCGTGTGGAG
CAGATCACATGTTTACAGTGGTGGTTGCATACTTCTAGGAGCTAATTTACTGTCTGATTT
CCCGGATTAGGTTCGGGAACACAACAGAAAACTGAGAAAAGAGGCGAAGAAGAAAGGAGT
GAGCAAACGGGTGAAGAAGGACCCAGGCGTGCCCAGCATTGCACCCTTCAAAGAAGAGGT
CCTGCGAGAGGCCGAGCAAAGGAGGCAACAGGTCTGCTCCCAGATCCCCTTTCTAATGAA
CCCTTGTCCTGCAGCATCGGTTCAAACCAAAGGAATGCTTTGTCAGTTTCCTAAAGTTGA
ATCTGTTTCTTTGATAGATCGAGGAAGAAAAACTGAAGAACAGAGAAGCTAAAAAAGAAC
AGCGAGCCCTGAAAAGAAAAGAAGCTAAAGAGGCTGCAAGTAAAGAAACCGAGCCCAGTG
CCAAAAAGGCTCGACAGGTTAAAAACCCCACAAATCCTCCATCTGTTTTCTTTATTGTGC
ATTTGTTTTCTTATCTTCATTCTCCTTGGGTGTATATCCACAGGAAGAGGGTAGAAAGCC
TTCTGAAAAGCAGAAAGCTGTTGACAGGAATTCGAATAAGCATCTTTGCTCTGAATTAAA
CAAGGTAAGATGTGCTGATCACTCGACAGATATGTAGAAGTTGGGTCATCTTCAACCAGA
GCTTTCCCTCTGCTTTTGCAGGTGATTGATGCGTCTGATGTGGTGATAGAAGTCCTCGAT
GCGCGGGACCCTCTGGGCTTTCGGTGTCCACAGCTGGAGCAGGCAGTGCTCCAAAGAGAA
GGAAACAAGAAGCTGCTTCTCGTCCTAAACAAAATAGGTGAACATATTTACGTCGTAGCT
TCAAAAGTACAACTCGATGCTTGGTCTTGAACATTACCTTGGATTGTGTGTTGTAGATCT
GGTACCAAAGGAAAATGTACAGAAGTGGCTTAAGTGTTTACAGGCTGAGTTTCCTGTTGT
GGCTTTTAAAGCTTCGATACAGCCTAGTACCAACAAAGCGGTAGGTGGTTCATTTTGTTA
CACATCCCGTCTACAGATGTGGAGGACTGAGAAGGTTGAACAGTTTGTGTTGTGCTGTTT
TAACTGGTTATAGCCTCCAAGATTACTAAACAAACATGCTAGATGTGTGGCTCTCCCTAA
AGTGGAGCTAAAATGTGTGTTTGCAAACATAACAAGAGCAAATTCTAAAATTCTGGGCAC
AATGGTGTTTTTTGCCAATCCTGGTTACTAAAACTTCATGTCTTTGTTCATTACCAGCGA
GGCAAGAAGAGAAAAATATCCATCACTAATGAACTCATAGTCCAATCCAGAGCAACCACC
AGCGATGGAAGCAACTGTCTAACGCAGATCCTGACGAGATTGGCTGCAAAAACCAAGAAT
GGCGCTCCCCTGAAAGTGGGTGTAGTTGGTAGGTACAGAAAAGTCCAGTCCGCGCACACC
AGTGAAACCAATTCAAAGGTTTGACAGCCCCTTTTTTCTTTTGACATGTTTGGTTTCCAG
GCTTTCCTAATGTTGGGAAGAGCAGTCTGGTCAACAGTTTGAAGGGGTCTCTCGCCTGCA
TGGCTGGAATCAAAAGAGGCATCACGAAGTGAGTCACTTCAACACCCAGATTACAGAAAA
TGGACATTTTTCCGGGTCAAACATCGATGCTTTCCCTCAGATGTATGCAAGAGGTGAACG
TCTCGGACACTGTGAAGCTGCTGGACAGTCCAGGGATCATCGCCTCGCCAACCAACCCCC
AGGTCTCTCTGGCTCTGAGGGGTCTGGTGGTGGAGGAGCGCAAGGAAAGCCTTTTGGAGG
CCGTCAGGTGTCTGCTCAAGCAGTGTGATCAGACCCTGGTAAGAAGAATCTCCATTGCAA
GAAACACAGATTTGAGTGTTTATTTTTGTTTAAAGTTTTTTTTTTTTTCCCCAGGTTACG
CTCCAGTATAACATCCCTAACTTCCGGAACTCCTTGGAGTTTTTGACCATGTTCGCCAAG
AAGCGTGGCTACATGCAGAAGGGTGGAGTCCCGAACACGGAGCAGGCAGCCACAGTTTTC
CTCACCGATTGGACCGGGTGATTACTTTTATGCTTCTTTTATTTCAGTAGAGGGGAGAGC
TTCATTTTGGACATGAGGACAAAAAAGAATTTCTGGATTTCTTTCTGAAGACGTTTAATC
CAACTCTGATCCAAGAGGAGAGCTGCAGTGTTGAACCAGGAAGGGAAAACTTCAGCCTGA
TCTCAGATCTTTGTTTTTCTTTAGACCGAAGGTCAGCTACCACTGCAAAGGCCAGGACAC
CCACCATCCCCCTGCCTACGTGACTGATGCCGTGGTCTCTAAGATGCAAGACGACTGGGA
CCTGAAGCAACTTCAGAAAGGCAACGAGGAAACTCTAAAAGGTACTGGTGCTTTACTCAG
CAGGCGACAAAGGTAGCATTGAAAAACAACCCTGATTTTCTTTCTCTGTATTTCCTAACA
GGCGTTAGCTTCCCAGGCCTGGCCAGTAGCGTAATCTTCACCTCCAAAGGCCCCACGGCA
GGTCTGGTGAACGTCTGCGACATCCCTGAGGAAAGCCCTGCAGCCACAGAAGGAAAACCG
GACCAGAATGGAAACAATGAGGTGATGTTTGTGAACGTATCGCCGCTGTCTGCTGGAAAT
GAGGACAAAACTGCAAGTCTTGATTTATTTATGAAGACTTCTAATCCAACTCTGATCCAG
CCTTTTTTTAAATTTCAAGCACTGAAATTGATACCCAGCAGTTGTACTTGAACACCTGCC
CTTTTTCTCTTTCAGTGTGAAGAAACCTCTGAGGAGCAGAACAAAGAACCAAAAAAGACT
CCAAAGAAGCCTCTCAAAAGTAAATATTTAAAATATATCTAATCAGTTGAATTTATCCAG
TAGCTTCTTTACACCTTGTTTGTTTTTCCAGAAAAAACAGTTCGGTTTCATCCCTGTCCC
CGTTGACCGAAGCCTGGCTTCAGACGACGCCTACGACTTCAACACAGATTTTCAATAACT
TTTTATCTTCATGCTCCAGACCTGGATTTGTCTGCAAACACAACAACTGCTCAGTCTCTA
GATGCACTTGTTGCTGCTTTTGTGTTGAGACGGAATAAAAATTCCCCTTTTCCGCTGATA
CAGGGTGGATAAACTCATCAGAAACCACTTTTGGAACTGCAACGTTGTCCTGATACAGTA
ACGTGGTAACGTTGATCTTTCAAAAGCTGCAAACCTACTCTCAGCTGGCTTCCTCAGCAA
GAAACGTCAGCCATCCCTCATCTTTGTTGTAAATAGGTAAATCATGCGGACGATGAGCAG
TAACATCGTCTGCTTCTGCTCCCAGTTGTCTGAACATGAGATCCCCTGAAAAAATCTGTA
CATAGACGACTAATAAATCCTTTACCAAGTGTATTTGCTACTCTGATCCTTCTGAACATC
TCACTGTACATTAAAAAGAATTTAGGCCTGAAAATTTGACAAAATTATCTTCATATTTTC
CACAATGGACCTGCATCGCTGGACAAAATTCTAAATGTGGAAACACTTTATTGCACTTTA
AAAATACACATTCAAACAATATTCTTGTAATGTAAAAAAAAAAAAAAAGTAAAAGTGGTT
GCTAGTGTGAATATAAAAACACCTGTAAAGTACTGATTAAAGCATTAGTAGGTGAGGTTA
ACCCACCCGTACTGGATCTGACCTTTAAAAGAACCTGTAGTATTTACTACAAAGCACACA
AAGATATCAAACACTAATCCTGTAAAGATTCAGAAAAACAACGAGGTAAAAGCATCTGTT
GTGACAAGCTGAAATAATTCAAGACCCTAATGACTGACCGCTACACTGCTTTTAAGGTAC
ATGTATTAAATGTATCAATATATTTCTATATATATAAAAAACAGCTGTTGTCCAGCGGTA
TTTAACATGAAATGTTGAAACCGCATGTTTATGGTTACAAATATGGTACAAAAAGACATA
AAATATACATCATATTTGGAATAATACCTTTTTCTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1013, 1206..1265, 1391..1530, 1637..1756, 1843..1923, 2001..2136, 2216..2319, 2577..2727, 2820..2907, 2980..3157, 3234..3376, 3564..3700, 3781..3920, 4095..4166, 4231..4317
1001..1013, 1206..1265, 1391..1530, 1637..1756, 1843..1923, 2001..2136, 2216..2319, 2577..2727, 2820..2907, 2980..3157, 3234..3376, 3564..3700, 3781..3920, 4095..4166, 4231..4317
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved