Tetraodon_nigroviridis Locus nop56
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis nop56
Tetraodon_nigroviridis
nop56
11
SNORA51, SNORA26, SNORD57, SNORA42
2738..2864, 3170..3288, 4652..4716, 4929..5056
6401
CTCAGATTACTCTGCAGGAGCGGGCCGTTGAAACCGGCACCAAATTCAGTGCAGTTGGA
GTGTGCACAGACCGCAGTTTTGTATCTTATCTGCAGCTCTTTTTTTTGCAGCACGGCCGT
GACGCACATTCTTTTGACGCATTTTTGGGTCACTTATCGGTTAGGGTTTTATTGCTGGCT
GCTATGTTCTCTGAGGGGAAGAAAAAAGGGTTTGAAATGAATTCCATCTGTTCCAAGGAC
TTTCAAGCAACCCCATGTTTATACTAGATCAAAGGAAAAATGGAAGGAAAATAGATTAAA
AAAGACAGCAGATGAAGACTGTATTTGCATAGACATATTTTTATAAACCAATAGCAGTCA
GCATTCCCTTCTATTTATTTCAGCTGGGTGTCTACAGCAAATGATAATGTAGTTTAAGCA
TTTAAATTGTCCCTTTTGTGTGCAGAAATAGTTGTAAAATGCTTGTAAAAGACAAAACAA
AATGCACTGGAGGTCATTAATTACTGATGTTGTTTAAGGCAGTTTCATAAATACAACAAA
AAGGAAGACAATCAATTACCTACAAAAAGAGCTGGACAATGGTAAACCCATCTGCATTTA
CAAACACACATGTTTATGAACGTTCTATCGACTGTTTCAGTGGTTTTTTTATCTCATATT
GTACAAAAAGGTTTCGTTGAGAGGAGAACCTGAACTCTGCTTGTTAGTGAAAACGCTTTA
ATTACGATTACAGTTGAAACAAATTAGGTTTATATGTTGCGCTGGCGAAGCTCCCGGTGT
TGTTTTTGTTGAATAGATAGACAAAGACGAGTCTTACCCTTTTGATTTGTTGAATTTTGT
TCCGTTTTACTTTGACGCGAAAATCTAGGACTGACATTCTGCTGTTTGGCCGCTAGATGG
AGTCTAACACGCCTCTTCTCGCGTTGCTAGGTAATATCGCGAGATCGACTGCACGTGGTC
TGCAGCTGAAGCTATTGGCTGTGAGCTCGGCTCGCCACATCTTTCTTCCGAGGTGGAGGT
GGCGAGCAGACGTGTTGTACGTGCTGCTTCAAACATTTCTAAATCATGGTAAGCTAAGAC
TTTGGTCGTTTTCTGGTACCCGGTTAGGACATTGAGAGACTATTGGCGACAAAAAAATGA
ATCCTTGGAAACCCAAACTGTTTGCTGGTGACCATTTTAAGGTCATTATTACATTGGTGC
GCTAGCTGCCGAAATGGCTAACATTAGCTCGACTTCGGTGCTATAGTTTAAACTTTGTAT
AGATTAAAACCGACAGGTGCATCGTGCGCAGCCCGATGATTTCCCTCTAGTCTTTGGCAC
GTTAGGGTTATGTTATTAATTTAAATACTTGATGAGGACAAATGGAGCTTTTAGCATACG
TTAGCATGGTAGCACGCTGCAGCCCGGGCCTAGCGCAACACGTGGGTCTAACTTAGAATC
GTGGCCACGCAAAGAAAGCTGAGAACTTGCAGTAACTATTTCACGGAAATGTAATTTCAC
GAGTTATTACGCATGCTAACAGGGGTACAAAGGGTTTGTCTTTTTTGCCGGATTTCCAAA
CCACCACGTGAAGGACGATCGTGATATATTGTGCATTTAGATCACCTCGACGGTTTTGGT
TGGTCAGGTCAAAGCCCAGTTGTCCTCCACAGGTGCTCCTGCACGTGTTGTTTGAACATG
CGGCAGGCTACGCGCTGTTTGCCGTGAAGGAAGTGGAGGAGATCGGCATGCTGCTCCCGC
AGGTGGGCCCGGCCGCCCGCTGACGCTTCCCCCACCCGGAGACGCGTTTTCACATCTGGT
CTGTCTTCCAGGTGGAGGAGAGCGTCCTGAACATCGGGAAATTCAACAGCATGGTGAGCC
TCGCAGCCTTTTTCCCGTTCAAGTCGGCACAGGCGGCTCTGGAGAACATGAACGCCGTTT
CCGAAGGTAGGTTCTGGTGCTTGGAGGCTGGAAAGGACAATTCCTCGGCTGTTGTGATGT
CTTCATAATCTGTCAATCCACTGAAACCTTGTGCTGACGCTTCCTTTTGATTCTGAACAA
CTGAGGGACACACTGGAATTGAGAATGAGCAGATGTTTGGCAGATGTTCGAGGCCGTTCG
TCTCAGAGGGTTGTCCTCCGCCTCCTCCGCCCGTAGGTGTGGTTCACGCAGACCTGAAGT
TGTTTTTGGAGACCAACTTACCCGTCTCCGGAAAGAAGAAAGCCACGCTGGGCGTCTCGG
ATGCCAAAATCGGAGCCGCGTTACAGGAAGAGTTCAACCTTTCCATTCAGACGGGCGGGG
TCGTGGCAGAGATAAGCCGAGGTGAGACGGACCCCCGGATTATTTGGATAAACGCCGACA
AACTAAAGAAGTCTGATCAGCCGGGCCTGTAATGATGAACGCGTGACCCCGAAAACCATG
AGGGCTTTTATACTGAAAATCTGAACAGCCGCAGAGATCCTTCGACACTCTGCTGCTTTT
GTCACAATATCCCAACTTCTCCGCGATTCCGATTCCAGGTCTCCGTCTGCATTTCCACTC
CCTGGTGAAGGGCCTGACCGCGCTGGCTGCCTCCAAGGCCCAGCTGGGGCTGGGTCACAG
CTACTCCAGGGCCAAGGTCAAGTTCAACGTCAACAGGGCGGACAACATGATCATCCAGTC
CATCGCCCTGCTGGACCAGCTGGACAAAGACATCAACACCTTCTCCATGCGCGTTCGGTG
GGTTTCCGCCGTAGGTTCCATCGTCCAGACCCGCCCTTGGCCTCCTGAAGCTTACCACAG
ATGGTACACCGCAGTACCGGCTGTATAGAAACAGGAGGGACAGTAACCCGCCCCGCACGT
GCGCTCCGCCGCTCGCCCGGCGGAGCCGTCCTGTGGGGCAGAACACCTTCCCGCTTGGTC
ACGTGACCGCGCGTGCGGTCAGGCCTCACCCGGCTCCCTCCCTGTGTGCAGCGAGTGGTA
CGGGTACCACTTCCCCGAGCTGATCAAGATCGTGTCGGACAACTCGGTGTACTGCCGCCT
GGCCCGGCTCATCGGCAACCGGAAGGAGCTGACGGAGGAGAGCCTGCAGAGCCTGGAGGA
GGTGGTGATGGACGGCGCCAAGGCCCGGACCATCCTGGACGCCGCGCGCAGCTCTATGGG
TCAGCACGCCTGGTTTTCCTTTGGCCTCGGTCGACACGGTCGCCCCTTATTTGCCCACCT
CAGGCAGACCGTTGCCTCTGGTGGAAACACAGGGGGGCAGATTAGCTCTCTCATAAACCC
GCCATGACGCCGCCAGTCGTCATGGCGGATCCTGTCGGGAGAAACAAACAAACAATCGGC
TTCTTCCGGAAGCGGCGAGCGTTTCTAGTGGCATCCCCCCGCTGACGGGAGGGTTCTGAT
CCCCACCCAGGCATGGACATTTCCCCCATCGACCTGATCAACATCGAGAGGTTCTCGGAC
CGCGTGGTGTCTCTGGCCGGATACCGCTTGGAGCTGCAGGAGTACCTCCGCTCCAAGATG
AGCCAGGTGGCTCCGAACCTGGCCGCCCTGATCGGAGAAGTGGTGGGTACAACCTCTTCT
TGATTTATTTTCCTCCCCCAAGTCGGACCGATGATGTTGTACCAATATCTGTCAATCCCC
TGAGTCACGGTGACGACACCAAATCCGGTGCTGATGGTCCGGAGGGTGGAGTACACGCCG
ACTCTTGTCCGGTTTGTCGCTGAGGCTCCGTTGCTTTTGACTCCAGGTCGGCGCTCGTCT
GATCTCCCACGCCGGCAGCCTCACCAACCTGGCCAAGTACCCGGCGTCCACGGTCCAGAT
CCTGGGAGCCGAGAAAGCCCTGTTCAGGTACTGGGGCGCCCCCGCCCTGCTGGGGAGCGC
GGTGGCTGCGGTGATGGCAGGGCTGGGCCGGAGCAGAGCAGGGTGACCGGGGGATTCTCT
GGGGTGATCCCTCTCCTCCCGACGCACTCCCACAGTCTGAGCGGCCACTCGGAGCGCCGA
GGTGGAAACGTTTGACCCTGGTCGCACAAGCCGGTTACAACATGGTTAGAATTCACTTTG
ATGAGGAACATAACGAGATCTGCCCTTAGGGGGCGCTGTTTAGCCAGGATCAGCCAGGAA
AATGTCTTTTCTGTCGATTCTCCGCCTGGCTGACCGTGAAAACGGGCTCTCCTTCCCAGA
GCCCTAAAGACGCGCGGGAACACCCCCAAGTACGGGCTCATCTTCCACTCGACGTTCATC
GGGCGCGCGGCAGCCAAGAACAAGGGCCGCATCTCCAGGTACCTGGCCAACAAGTGCACC
ATCGCCTCGCGCATCGACTGCTTCTCCGGTAGGTGGAACGTGCAGACCTGTCAGGCGTTC
AGGCGCATTTCCCGTGGCGTTGTTGCAGTGATGCTCGTATTTTTCGTCAACAGCATTCAC
CCCTCGGTGGTGTTGAAAACCGATTCCTGAGCAAACGCCACAGAAACTGCTAGCGTAGCG
GAATCCTGTCGCTTTGGGCTTCTTTTTTGAAACGCCGGCTCTTTCCTGCAGAACTCCCCA
CGTCGGTGTTCGGTGACAAGCTGCGCGAGCAGGTCGAGGAGCGCCTGTCGTTCTACGAGA
CGGGCGCCGTGCCGCGCAAGAACGTGGACGTGATGCAGGAGGCCGTGAAGGAGGTGAGAA
ACGCGTTTCCCCGCTGCCGTTTGTCCCGCCGCTGTAAGTGATGACCCCTCTTCCCTGATG
TCCCTGAAGGTCAAAACTGGTTTAATGAGCCTGATGCAGCCGGAGGGTCGCTGCTTTCAC
CGCAGTCGAGGCGCGCGCGTGTTCTGATCTGCTCGTTTTCGTGTTTGCGATCTCAGGCTA
CGGACGCCGCAGCCCGAGATCAAACGGAAGTTGGAGAAGAAGGAGAAGAAGCGCAGGAAG
CGGGAGAAGCTGCAGCAACAGGCGAACGGTGACGCCGAGGCCGAGGTGGGTGGCGCGACG
TGGAGCGCCGCATGTTTCGATTTGAGAGGCGACCCGGTGGTCCCGTCTCAGTGTACCGCA
TGCCAGAGCAGCCACGACTCCCAACCATTGGCCGGTCCCCAACCGTGGACCGGATCACTG
AAGCGAGTCGCACACGTGCGCACGCGCCCCGGGCACGTCCGCTGATCGCGGGGTTTCACT
TCCTCGTTCAGGTGGGCCTGGACGGAGGAGAAGCGGACACCCCGGCGGCGAAGAAGAAAA
AGAAGAAGCAGGCCGAGGAAGACGCGGCCCCAGCAGAGGAGGCGCCCGCCGCGGAGGAGA
CCCCGGGGAAGAAGAAAAAGAAGCGGAAAGCTGAAGCGGAGGAGGCGCAGGCGGAAGAGG
AGGCAGTGACTGACAACGGAGCAGGGGACGCTCCAGCCAAGAAGAAAAAGAAGCGGAAAA
GCGAGGCGACGGAGGCAGAAGAGCCCGCTGAGGCGCCTGTGTCTGAGAAGAAGAAAAAGA
AGAAAAAAGCAGGAGACTAGAGAATCTTGTGTTTTTTGTGTACAGATGTTTTTTTTTTTT
TGGTTTTACTCGAGATGAAGCAGCTTCGTGTATTAGACAGCAATGAAATGCTTCTGTGCC
TTGAAGATCATTTACTTGTACTTATGTAAATAAACTGATTGTATGAATTGGTGAACCTTG
TTTTTGGTTGTATTCCTCTTTTTCCTTAAATATTATACACTAACCACACACATTTATATT
TAAAAGCAGGCTTCGCACCTTAAAATTTGCTGTTAATGTTTCTTCATTAATGCTTAATTT
TCAAATGCAAGGATTTTGAGTGGTAGGAGTGTGAGCAGAAGGTGCAATTAAGCTTTTAAA
AATGCATGATTTCACCTTTAATTATTGGGTAACTAGCCTTCAGTAATTTATTGGAGCTCT
TTGAAATTTCAAGAATGAGTTCTCGTATAAAAGAGGAAAGTTCAACTATAGGAAAAAAGT
AAAATTGATAGCAAACATGACTTTTTTTCTTATTCTTTTAATTTGGACGACAATGATTAA
ACCAATGTTAAAGACATCAACTCCAAGGCCTGGCTGATGACACCAGCCGACTAGAAAACA
GAACGGGGGTGGGGGGGCCAAATCAAATGGCTCCAGTCACCCTCAATGAGGATTCACAGA
TGTGGGAGACCAGAGTAACAAACTTTTCCTAAAATTAAAAAAAAAAAGCCTGCCATGAAA
ATGATGTGTAGAATCTATGTACATCATTCTCCATTTATGTATGCATACAAAAAAATCCAC
ATCACATGATGCTCGTGTTCAAGTATATTCAACTTGTTATCTTTGCACATTTGTTAAAAT
AAAAACATACTTCGAAATTAAAAAAAAGCAGAAAACCACATTTTTATGTCCTACCAATAC
ATATATACTGTATAAATACATACATAAATATATTTTACATACAACAGCCATAAATTTGAA
AAGGGGGATGTACAGAGCAAAGAGAGGGGGTGGGAGTGTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1652..1741, 1811..1925, 2136..2300, 2498..2696, 2931..3118, 3370..3521, 3706..3806, 4139..4287, 4491..4608, 4796..4904, 5111..5401
1065..1067, 1652..1741, 1811..1925, 2136..2300, 2498..2696, 2931..3118, 3370..3521, 3706..3806, 4139..4287, 4491..4608, 4796..4904, 5111..5401
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved