Tetraodon_nigroviridis Locus rplp0
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rplp0
Tetraodon_nigroviridis
rplp0
11
SNORA63, SNORA63
1763..1891, 2162..2292
4310
AGTGTTTTTAATAGTCAGGGATTTTAAATTTTTAAAGGCGTCGAGGCGTTGGGAAAACG
CCAAGTCGCGGCCGCCCATGACCACGGTGGTGACCGCAGGGAGCTCCGACGCCACCACGC
GGACGTGTTCGGAATTACAGTCTATTAGCTCCACACTGGTTACTTTTCTCATTCGAAGAG
TTCTCCAAAAGTAGGTATCGAAGCGGCCCTTCTTAAAGTCCAAAACTACCGACCAGTTTC
TCCACAGCGACGGGTGGTCGATGAGTTTCCTGAAATAAGTACACGACGCGCGGACGCATG
CCTTCTCGGCAGCGGACAGATGACTGAAAACGTGGTTCCAAACCTCTGAGGGAAACAACT
CGGCCGGATTCACCATTATCTTCCAGGCTGTTTGCGTTTTCTTCCACACGGTAAATATGT
TTTCCGATCTTGTCTCAATGGTAACTTTTTTTGTTGTCGGTCACGTGTATGCCAACCCGG
AACTGTGCCTCACATCATTTCTGCGCATGCGCGAACATGTGCGCATGCGTCGATACTTAC
TGTTTTTTCCACGCTTTATGTGACATTTGTAGAATATGTAGAAATTCACAAGACCAAACT
AAATCTTAAACAGTTTCAGGGTGCGTGCCACCGAAACAAAAGTTTACAATAATGTCGTAG
TAAATATTTGTACTTGGTGAAAAATTGTGCACCAGTAAACACAAAGAATAGCAAATTATT
ATTTACCTAAAGTTAAAAAACGTTGAAACATAAAACTACTAAGAGTAAACTTAGTATAGA
AATTTTGAGACAAAATTCAGAAAGAAAAGAATTTCAAATATTAATATAATATAAATAATT
TAGCTTGAATAAATAGTTTGGATCTCACTCCACATCAGTTGGTGGCGGTAATGCACCAAT
TACCAGAAGAAGACGAAGAAGAAGATTGATGTCCCAGCTATCCAATAGCGGCAGAGCTTT
TCCTAACTGTACTCTCATTGGCCACTTGCCTGGTATATATAATCCTCCTTGCCTCGCGCG
CTTCCTCTTTCTTTCACGCGACCCTCGTGTTTAAGGTGTGTAATTTTTCCTTCCGTTTTT
AGCAGACCGTAGTTTTGTAACACAAGCATATCATTTTAGTATTATGGACCAAACGTAGGT
GGTAATAAATTACCTTGTGTGTTGTGTCTAACGACGTAATCCCCTACCCGTCAGAATATA
AAATCTGTTATAGCCTAGCGCGGCCTGCTAACGCTAGTTTGCTGCTAGCCGTATTAGCTT
GGCTCCTGAGCGGCGCTGTTCAGACCATTCTGGAATACTCACTGATGGTGTAACTCGATT
CTTTTTGTTTGAAATCAGGTTCAACCTTGTCTTTAAACCAGCTCTTAAGCGATCCTTGGA
AGCACTGCAAAGATGCCCAGGGAAGACAGGGCCACGTGGAAGTCCAACTACTTTCTGAAA
ATCATCGTAAGTTTGTGCGACGCGTAGACGCATTATTAATTAAAATGTTAAATCCTGTAG
GGTTTTTATTCACCCTCTTCCAAACCTAAGCATTTTGCCCCGTTTTTTTTAATTTTAGAA
ACTTCTGGACGATTATCCAAAATGCTTCATTGTGGGTGCGGACAACGTGGGCTCCAAGCA
AATGCAGACCATTCGGCTTTCTCTTCGGGAGAAGGCTGTGGTCCTGATGGGCAAAAACAC
CATGATGCGTAAAGCCATCCGCGGACATCTGGAGAACAATCCTGCCCTGGAGAAGTGAGT
TGGTTTGTGCAGAGATGTTGCCGTAGCAGGATAAGTTACAGTGCAGCTTGTGAAGTGCTG
TGTTGTCGTTCCCCCTGCAAAAACTAACCTGTTTCCAGCTATCCCTGCTTGTCTTCCTTC
GTAGACACCCAGGGACGCAAGGTCTCAAACAGTTGCCACTTCTGTCGAGTTTTAAATGTG
ATTTCGTGTCTGGATTTCTGCTAATTGTTGTTTGGTTGGACAGGCTTCTGCCTCACATTA
AAGGAAATGTGGGCTTTGTCTTCACCAAGGAGGATCTTGCTGAGGTCAGGGATTTGCTGT
TGGCCAACAAGGTAACTTTCAAGAATTTACACACGTATTCTTGCTGACAGGATAGGAGTT
ATAGTGACGTTTCAACTAATTTCATGGGAAACGGGTGAAACTCAATCACAGCGAGCGCGG
CCATGCAGGTTAGGTTACAACGCAGCCTGTGAAGTGCTGTTTTGTCGTTCCCCCTGCAAA
AAGTGACATGTTTCCTCGCTATACCTGTCAAGTCACCCTCTCTTGACTGACAGGGACGTA
AGGTTTCAGACAAGTAGCCTTACTTTTTTCATGCTTGTTGACAACCGCTGTTTTAGGGTT
GATTTGTTTTGTGGTTCATTTGAGGTACCTGCAGCTGCCCGTGCTGGAGCAATCGCCCCT
TGTGACGTGACCGTGCCTGCCCAGAACACTGGACTGGGTCCTGAGAAGACTTCCTTCTTC
CAGGCTCTGGGTATCACCACCAAGATTTCTAGGGGAACCATTGAAATTTTGGCAAGTGTT
TTTATTCTTTTTTTTTTTTTATTTGATGGCTGGGCTGAGAGTACCTGGTTTTAAAACCAA
GTGTTTTACCTTTACAGAGTGACGTCGGTCTGATTAAGATCGGCGACAAGGTCGGTGCCA
GCGAGGCCACGCTCCTCAACATGCTGAACATCTCGCCCTTCTCCTATGGACTCATCATCC
AGCAGGTTTATGACAATGGCAGTGTTTACAGCCCTGAGGTGCTTGACATCACAGAGGCTT
CACTGCACGCCAGATTCCTGGAGGTGAGGTTCAACAATGCGCGTCACAATTCGCTCACTT
TTTTTGTGTGTGATGCTCATAATGTCCGACTTGTGACCTAGGGTGTGAGAAATGTTGCCA
GTGTGTGCCTGGAGATTGGCTACCCCACTCTGGCCTCAGTGCCCCACACCGTCATCAATG
GTTACAAAAATGTCCTGGCAGTTACTGTGGAAACCAACTACTCCTTCCCACTGGCAGACA
AGGTACGCACACAAAAACTGGGGTTTTACGCTTGTGCAATTGATAGAAGAAACAACTCAA
GATGGAAACTCATGTATGGATTTGCCCCTGCTCACAGGTCAAGGCCTACCTTGCCGATCC
TTCCGCCTTTGCTGCTGCGGCACCTGCAGCCGCTGCTGAAACCGCTGCAGCTCCGGCTGC
TGCTGCCAAGGAGGAGGCCAAGGAAGAATCTGAGGAGTCAGATGATGACATGGGTTTTGG
CCTGTTTGACTAAAGCAAATGTAATCGTGAATCAATGACACCAAGATTCAATAAAAAAAA
GGATACATTTATGCTGCCTCCTGTTTGCTTTAAGAAATGCATTTATGGTATGTGGTCAGG
CATGTGACTGGCTCAATATGGAAAGACAACTTTGACAAAAATGATAAGGAAATGCGTTTA
AGTTATCAAGGTTGGCTACAGCTATTAGATTTCAGAATGTGGAGGCAGATCTAAGGGAAG
TGCAATAGTGTAAGGTCTGGCAGTTTGTGTAATTAAACATTCAGGGGTCTCTTTGACCAA
TGTTAAATAAAGCTACGGCAGGAATAATAGAACAAATATTCAAAATGAACATTGTTTCAT
TAAACTTTTAGTTGTGAAAGCGGTCCATTTCCTAAGGACTACGTTTCAAAAGCAGACTTT
TATTTCTTAGAAAACACCGGAAGTCGCATCCGTTTTAGTACACTGGTTTGATGGTTGGTT
AGCGTTGGGCTAGTCCATTATGGCTGAGGTAAGACTTTGTCTATCAGGATTTTACGATCT
ATGAATTGTATCTCATTAATAATCGCGTCTTTGTATGCGTTAAAATGTCAGTTCGTATTG
TTTCTAGACGTCGTCCCTCTGTTTGTCGATGCGTTTATTTGTAAGCAGACAACGCAACGC
CGTCTTAGCAAATGCTAGCTTACCATACACGACGATATGATTCTACCTTTAAAATGTAGT
CATTATTTTCCTTGTAATGTTTATTTTTCTGCGAATACTTTTATAAAGATCATCGATGTC
TCATACATCCGTAGTGTCATTATATTACTGGGTTAAAACGGAAATATCGTGGTGTTGAAA
TGTTGACTGGCCTTGCTAGCGGTTGAGTAGATTTCTTTTTATTTATTTATTTATTTGTTT
GTTTGTTTATTTATCCGGGGCGCTGAATAAAACAGATCGAATGTACATTTCTGTCTCAGG
ATAAACTGGTTGTGACAGTGTAGTTAGTGGGACTGCACCATTTCTACCAAGTAGCCGCAG
TGGACCCTAGCGCAGATGGACCCCGGGGCCTCGCTGGTGGATCGGCAAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1054, 1338..1445, 1558..1733, 1963..2050, 2364..2510, 2597..2782, 2861..3001, 3097..3310
1392..1445, 1558..1733, 1963..2050, 2364..2510, 2597..2782, 2861..3001, 3097..3252
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved