Tetraodon_nigroviridis Locus Mono:SNORD33
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORD33
Tetraodon_nigroviridis
Mono:SNORD33
10
SNORD33
1001..1084
2084
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTCTGGTGGTCGTTCGTTGATCGTCTGTGATGTTCTT
AACCACTATAATTCGAGTTTCAATGACAATGAGACAACCCTACATGCACTACCATCTGAG
ACATCTGCACTACACATTGAGATCAAAGTAAATCATTCAACCAATTCTAAAATGTCTTTT
TGTGTTGTTTAGTGAAGTATCTTGCTTTCCTGCGTAAGAGGATGAACACCAATCCTTCTC
GAGGGCCGTACCACTTCAGAGCTCCCAGCAGGATCTTCTGGAGGACCGTCAGGGGTAAGA
ACAGGGAATTGTACAGTTTATAATCCAGGAAAAACAGGCACATAAATGAAAATACAAGCC
TAACACAAATGTGTTTTTTTTTTTTTTTTCTTTCTGACTTGAATAAGTAGTTATACTTTG
CTCAAATAATCTTAAACCCTTGCAGTGAGTGTGAGCGTTGTTCCTGTCTTTACTGTGATG
AGTGTTTAACCTCAAAGCTGATCTGCTTTGATGAGAGAGTATACGGATCTGATTACTGAG
TTCAGCAGGAACAAGCACATGTGTTTGGACAACCTGATGTTTTAATGGCCTCTCCTTTCA
AAAATATTGAACCTGAATGTTTTTGTCTAACTAGGGATGCTGCCTCACAAAACCAAGAGA
GGCCAGGCTGCTCTGGAGAGGCTGAAGGTGTTCGATGGTATCCCTCCACCCTACGACAAG
GTGATAAACGTTCATTTTAACTTGTACTGGTTTTATATGGTGTAACAAAAATGTGCCTTT
TGCATCAAGCTGATCTGAGTTTTCTTCTGCAGAGGAAGCGCATGGTTGTTCCAGCTGCTC
TGAAGATTGTGCGCCTGAAGCCCTCTCGCAAGGTGGGTTTTAAATAAGTATATGGCGCTG
TTTTATGTAGTTGCAGTTTGGCAATGAAGATCAATTTATCCCATAACTGATCAAGCTATT
GACGAGTCGTACTTTTGGATCTGATTGCTGAGTCAAGCTGCACTTTATACTGAATACCTT
ATTACTGAATTCTACTTTGATTGAAGAATAGATGTGGTCCAGTTTGTTGTATTAACACTG
AAAGGCTGTTTTTTTTTTTTTTCCTGTCAGTTTGCTGTCCTTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved