Tetraodon_nigroviridis Locus Mono:SNORA15
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORA15
Tetraodon_nigroviridis
Mono:SNORA15
10
SNORA15
1001..1134
2134
TTCATTTTTCATTGCAGGCTTGTGCAAAAAACAAACAAAAAGATATCATTTTTTTCTTC
ATCATGTCTATTTATGGTCAATTGAAGTCTGACATGAAGTCAACTGGACTGCTGGAAGAT
GTTTCCCTGTCAAAGTAGTTAAGTTTGTGTCTTTTGTTTGAAAATAATATTAGTTTGTTA
TTTGTGTTGTTTTTTTTCCCCACACACAAGACAACGCAATAAAATGTTTATTATTTTTTT
TATTATTACTAGATAGATTATAACATGCTGTTTAAATGCTGTTATATAAAGGGTCAATCA
CTGCATAAAAACATGATCAGGACGGTCTTTCCTCCAATTTTACACGAATAAACTAAAAAA
TAGACGACGTGTTTTTACACAAATAAAAGCAATTATTTTAAAACACAAGACAACAAACAT
CCAGTCGTGGACTTGTTTTCCGAACGAGTGCGGAACCTTTTATTGGAGCAGTTCAGACCG
GACTCTTTACGCTGTTACACAACGCCCCTCGTGCCTTCTTGGCGGTCGGAGCTGACCCGA
TGGGTGTATTTGAAAAGAGCAAATCTTTAGAATTCTGCATAAAAATGCTTATTGCAGGCA
AGACCGTTCGGTTTCTCTTCCACGTACCTGCTGATCGTTGAAAACGCCAATCTTACTATA
CGAAGGTAATTCATGTTATAGAGCCCAACAGGCACATGGCGCATGTTGGTTCGGATTTCG
AGGCCTTCTAATCGGTAATCTAATCGGTTTCACTCAAAATTCTGTGACTAGCATTTAACC
TCTTTAGTAATCACCAATTTGTGATCATTTCTCTTTTTCCTTTTGCCAGAACCAGGTTCT
GCAGAGATGACCTTCCATTCAAGGCCCCGTTGCAGGAGGGAACTATGAAGCTACATTCTT
GCAAATGCTTTCCGTGTTGAAATGTCTGGATGGTATGCTCATGTTGTTACACAGTAACAT
CTTTATCACAGTTGTTGTCTTGAGGGACACACAACATGGAGGCATGGCTGAATTCTGTTC
CAGCTGCGGAGTGGTGGATACAGTCAGACACCATGCCAGAGCGGGGCCTCCTTTCTGCTC
TTTGGACCGACGGCTTCTTTCTGCCTCAGTCAAATGTTCAGAAATGAGTACAGGAATATA
TCTAAATGATGCTGATGACACAAAACTCAACTCAAGTCAAGGTTGTGATATAAAAATAGA
AACGACAGCGCTCCCCATGCTCTTCTGTGTATTTGACTTTACTGTTTCTGTTCGCAGGCA
ATGCACTGACTCTCATCTGCCCAGGGACAGTCCAACCAGCTGATCGTTTGCAAAATACAC
AACAAGACCATAATGATTGAGATATTGGATGATATTTTCAGCTTTGGTCATCACGGTCAT
TCAAAAATGCGTCTTTGTTTAGTAATTGGCTGTGAAACGTTTGGCGCCGCAGCTGCACCA
GCATCACCTGCAGCATGCAGGAAACCATGCAGACAGTGTTTGAGACCAGATGAATGTTCT
CTACGGACTGTAGTTCGGTACTGAACTTGGTTGCAATAATGTGTTTTTGTCATTAAACCA
TAACAAAATTAAACAGGATGTTTGGGGTGTTTTGTTTTTTCATTAATCGTCTTGTTTTAT
CCATTAGACAAGTGTCTGAGCCAGTTATGAGCAGTAGGGCCTCTAATGTGTCCAGGTGGT
AACAACAAACCCTCCTGTGAACAACCGACAGGTACCACAAGAGAAACTAGACATTTACCG
AAAAATACTTAAATAATACTTAGAGCTAGCGTTTATGCTTCATAGCGCTTAAATATGTAA
ATCAAGTATGCAGGAGGCATTTTATTATCACAGATTTAACACTGAATGACCTGACAACTA
AAGATGTTTTTCAAGGTCACTTGTACCACCAGAAACTCAACAACTTTTTAAAAACCCTAA
TAAATTATCCACATTTGAGAAATAAGTTAAAATGAATACAATTGTTAGGTAAACTGTTAA
CAGCAACTCCAGAGGTAACGCCTTTTAAACCAACACAAAAAATGGTATTTTAGAGAGCCC
TGGTATTCGATATTACACCAGTTCCCTGTCCAAATACAAAATATTGGTACAACACTGGTG
GGAGAACCATCCCATGGAGCGCATCAGTCCAGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved