Tetraodon_nigroviridis Locus prpf8
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis prpf8
Tetraodon_nigroviridis
prpf8
10
SNORA38
2966..3101
14084
GCTAATTTATAACATGATTTTAACCTGCATATTATTGCTATTATTATTATTATTATTAT
TATTATCTTTTATTAATATTATCATTGTTTTGAAGTCCTCATTGCCGGCTGAGTAAAGCC
AGGTGTACTCGACCCTCCAATACTCTAGAGGGCAGTGTCATGCCGGAAACTGGAACATCC
GGGAACTTGGCAAATCGCGTTGAATGCCGCCTGCGTTTGTTACGTACAACGAACCTTGTG
GCTTCTGTCGTCCGTCGTGCGTGTTGCAGGTTTAAGAAGAGAAACTAGCACAACGCTGGA
AAAGAACAATACAACCCCCACGGGGTTGTGATTATTGAAGCAGTGGAGCACGTTTATATT
CAACGCTGAAGAAATAGCGAAGGTAGCAAGGTTAGTGGGTTTTTTTAAGCACCGTCGGCT
TGTTGTAACGTCCAATTGGGATTGCTGTTAGCTTTAGCGCTAAGGGTTCACTTCCTCCAT
TTCGGCCTAATCGGTAAATATCGTGCCAATAGCGACAAATAAGTAAAGTGTTCTTTTGAA
CTGAATTGTATTCGCTGTTTGATTTTATTCATTATAAAGCATTTAGATCAAGCAAAACAC
ACTTTTACTTTGTTGTAAAGGCGTGCGTTGGGATTGTATTTGGAGGCCATGTTGGTAAGC
TAACCGGCTAAGTGCTAAGTTTAGGTAAAAGTAGTTTTCTGTATGAAAACATGTAAACGT
GCAAATAGTATACGGCCTGTCTTGTTTTAATACTTGGTAAATTGGTGGACTTTACTTCAA
TATGTCCACACTGATTCATCCACATTATGTTTTATAACGTTGATCAACATTTAAGCGAAA
TGGCGAGTACAGACGACGAATTAGCGGGACCTACTACCATTCTATTATAGGTAGAGAAGA
CAAATTATTAGCTAATTTTTGTTAAAGGAGACCTAATCGTTTAACAGTGATACAGTTTAC
ATCATTTTTGAATCAACTTTTTTTCCTTTCAGGGAGACGCAATGGCAGCTACCTTCCCCT
ACAGACCGGTCCCTCCGGGGATGCCGCCAGGCGTTCCCCCCCCTGCGCCGGTGCCGGACT
ACATGTCTGAAGAAAAACTGCAAGAGAAGGGTATGTTAGTCTTTAAGATAAATTATTTTT
TGTAATAAGGTGACTTTTGAGAAACACATTTTTTTAAAAATGTCTCCTTTCAAATTACAT
AGCGAGGAAATGGCAGCAGTTGCAAGCGAAACGCTACTCCGAAAAGAGAAAATTTGGGTT
TGTCGATGCACAAAAGGAAGACATGCCGCCCGAGCATGTCCGGAAGATCATCAGAGACCA
TGGAGACATGACCAACAGAAAGTTTCGCCATGACAAGAGGGTGTACCTTGGGTAAAAAAT
AGATTAAATACTAAAGTTCATAATAATTGACTTGATTTTGTATGCATTATACTCATTTAC
TTTTGCATTTTACTCACCTTTGGCTCGTGCTGCTTTCTCTGTTAACTACCAGTGCCCTCA
AATACATGCCCCATGCTGTACTGAAACTACTGGAAAACATGCCCATGCCTTGGGAACAGA
TCCGAGATGTGCCTGTCTTGTATCACATTACTGGAGCCATTTCTTTTGTGAATGAAATTC
CCTGGGTCATCGAGCCAGTCTACATTTCACAGTGGGGGTAAGAGAGCACGCGCAGTAGCC
GATTATATTTTACAACTCACCCACAATTCATATTTCTGTATTAGCAACACATTAAATGAA
CAATGATCACATAAGTTGTTCCCTATTATTAATAAAGGGTTTGCCTCTGTTTGTTTCTCC
CAGAACCATGTGGATCATGATGCGTCGTGAGAAACGTGACCGGCGCCACTTCAAAAGAAT
GCGCTTCCCTCCATTTGATGATGAGGAGCCTCCATTGGACTATGCTGACAACATCCTTGA
TGTGGAACCTTTGGAAGCCATACAGATGGAGCTGGACCCTGAGGAGGACTCTTCGTGTGC
AGAGTGGTTATATGAGCACCAGCCTCTTAAAGACACTGCAAAGTAATTTTTTTGACAAGC
TTAACAACGGTCATTATGTATATTGGTTTAGCATATGTGTTTAAAACTACAATTTGTGTG
CTTTTTAGGTTTGTGAATGGTGCCACGTATAGGCGGTGGCAGTTCACGCTGCCTATGATG
TCCACGTTGTACCGCCTGGCAAATCAACTGCTGACGGATCTGGTGGATCTCAACTACTTT
TACCTGTTTGATCTCAAGGCCTTCTTCACCTCTAAGGCTCTTAATATGGCCATCCCTGGA
GGACCGAAGTTTGAGCCTCTTGTGAGGGACATCAATCTCCAGTAAGATCAACTCATTTAT
TTTAATCAAGATTTAGATAAAATGTTGGCCAGTTAAAAAATCTCATGGAAAGAAACTGTA
AAACTATGTGTGACTATTTAGCATAATAAGATGGTTTTTTTCTAACAGCCTGGTCTGACA
TACTTAGATTGTCAACACTAAATAGAAACAAAGCTTTGAATTAAATGAACAACAAAAAGA
TGCGAGGGATCGCTGAGTTTTAATTTTGCTCTAATCTGGTTCTGTTTTATATCCTGCAGG
GATGAAGACTGGAACGAGTTCAATGACATTAACAAAATCATCATCCGTCAGCCCATCAGG
ACAGAGTACAAAATTGCCTTCCCGTACCTCTACAACAACTTGCCACACCACGTTCACCTC
ACCTGGTACGGTTGACTTAATGTACTCGTACCAGCTCTAAATATACTTCAGAAATGTGAT
CATTCTACAACGATGACGTGCTTGTAATATCACAATGATGCATATTGACGTGTCTGCAGG
TATCACACACCAAATGTGGTGTTTATCAAGACAGAAGATCCAGATCTTCCTGCATTCTAT
TTTGATCCATTGATCAACCCCATTTCACACAGACATTCTGTGAAGGTAGGCGGATAAATG
GAGCAACTTAGAAATTTAGAAGTAGGTCCTCTTACAAAGGCGCACTTGCACTGGTTTGCT
TGTCTGTGCGTAAGAACTGGAGGAAAAGCAAAATGAACAGTGACGACTTTTCTCTGGCTG
CACTTGCAGTTGACCTGCGTCTGTTCAGATATTTCAATTCAAACTTGGAATTCTCTTTGA
TTTCATTCACATGTTTTATCATCCTCACATGAATGAAATCCATTTTTCTTTTATGCCTCA
TTTTAGAGTCAGGAGCCTCTGCCTGATGATGATGAGGAGTTTGAGCTTCCTGAATATGTG
GAGCCCTTCCTCAAGGAGACCCCTCTGTACACAGACAACACAGCCAATGGCATCGCCCTG
CTGTGGGCCCCGAGACCATTCAACCTCCGCTCTGGCCGCACCAGGCGTGCCATCGACATC
CCTTTAATCAAGAACTGGTGAGTAAAACGGCACCAAGCTTGTGGAAGACCAATTCATAAG
TTGTTGATGGAGTTATTTTACTTTACATATTTTAACCTAAATGTCTGGCAGGTAGAGGGG
ATTTTAGATCAGTTTTAGAGAATTTAAAAGATAAATGTGTTTCAGGTATCGTGAACACTG
TCCCGCCGGACAGCCAGTGAAAGTGCGTGTGTCATACCAGAAACTGCTCAAATACTATGT
GCTGAATGCTCTCAAGCATCGACCACCAAAGGCACAGAAAAAGAGGTAAAACGTGTAGAT
TGATGATGGAAACCCGTTTTCCTGTTTTTGCCTATAAAGTTATTGGCTTTAATCAGAAGC
TACAAATGTTTTTGATTTTTTGGGGGTTTTTTTTCAGGTACCTCTTCCGCTCTTTCAAGG
CCACCAAGTTCTTTCAGTCCACCAAGCTGGACTGGGTGGAAGTGGGTCTGCAGGTTTGCC
GGCAGGGCTACAACATGCTCAACTTGCTCATCCACCGCAAGAACCTCAACTACCTGCATC
TTGACTACAATTTCAACCTGAAGCCTGTCAAGACCCTGACCACAAAGGTGAAGTTGCCAT
AGCAACATCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTCTGTTGCTGCAGTAATAGTTATTCT
CTTTACAGTGGCAGCTAAAGTTTAACCATCACCTCTCAATTTTGTACTCCTGTAGGACGT
CACTCCAAGGGTGTAGCCAAGACGGTTACTAAACAGCGTGTGGAATCTCACTTTGACCTG
GAGTTGCGTGCTGCTGTGATGCACGACATACTGGACATGATGCCTGAGGGTATCAAACAA
AACAAGGCCAGAACCATCTTGCAGCACCTGAGTGAGTCCTGGAGATGCTGGAAGGCCAAC
ATTCCTTGGAAGGTCTGTGTCGTGTGGAGCTTGATTATCATTAAACATAGATTTTGGAGG
AAGGTGCTCAAGGTTTACGGTATTCACAGGCTTAATTAAGCTGATGTTATAGTTTTGTAT
CCACATCTTGTAATATTATTTTTGTCCAAAGTTTTTTTAGCCGCTGCAGTTCTAAAAGGG
CTTTTAGAATACCTTCATTATCTATTTTTTCATGTTTCGTTGTTGTTTCATGCGTACAGG
TGCCAGGCCTTCCCACCCCCATTGAGAACATGATCCTACGCTATGTCAAAGCAAAAGCTG
ACTGGTGGACAAACACCGCTCACTACAACCGTGAGCGTATCCGCCGTGGCGCCACTGTGG
ACAAGACGGTGTGCAAGAAGAACCTGGGGAGGCTGACACGCTTGTACCTGAAAGCCGAGC
AAGAAAGGCAGCACAACTACCTGAAGGTACGGTAAACACAGATGCTAAAGCAGACCTTAA
GCAAACCTTAAATCCTGTGCTTATTAGGCGCTATCCAGGTATTTCACTCACAGGTTTCAA
ATGGAACATAGTCCTCTTACAAAGGCGCACTTGCACTGGTTTGCTTGTCTGTGCGTAAGA
ACTGGAGGAAAAGCAAAATGAATGATGTGTCCTGGATCGCTGGCTGTGGTGGCAGCTGGC
TTGTCATCATTTAGATATTAAAAATCTCAATATTCATTTTTTAAATTTAGGATGTTATAA
TTACTAATGAATAAATCAGCAGTATATTTTGAAAACCTGTTGCATCTCCACAGCAGTAAT
TGCATTTTATCCATTTATTTATAATTCAGGATGGCCCCTACATCACAGCTGAAGAGGCAG
TCGCCATTTACACCACCACTGTTCACTGGCTGGAGAGCCGGAGGTTCTCACCCATTCCCT
TCCCTCCTCTGTCATACAAACACGACACCAAACTGCTCATCCTTGCCTTAGAAAGGCTCA
AGGAGGCATACAGGTAAACATCAACTAAATCCTAAACGTGTTCCTTTGTATGTTGTTTTG
TCTCTAGCAGGCATTCGAATGGCTATGTTTTTAACCTTTTTGTTCTACCTCCGGTGCCCA
GTGTGAAGTCTCGTCTCAACCAGAGCCAGAGGGAGGAGCTGGGGCTGATCGAGCAGGCTT
ATGACAACCCTCACGAGGCCCTGTCTAGGATCAAACGTCACCTGCTCACTCAGAGAGCTT
TCAAAGAGGTGCATATGCTTTGAAATGCCCCAGCAATCTTGTATTAAAACCGTTCCTTGG
GATCTAATCCTTATGTTATAAAATTTTACTGTTCATTGTTATTACCAGTTTCCCTCAGTC
CATGGTTAATGATTTCTCCTACAGGTTGGCATTGAGTTCATGGACTTGTACAGTCATCTG
GTACCAGTGTATGACGTGGAGCCCCTGGAAAAGATTACTGATGCCTATCTGGACCAGTAC
CTGTGGTATGAAGCTGATAAGAGGCGCCTCTTCCCACCCTGGATCAAACCTGCTGACACC
GAACCCCCACCTCTGCTCGTCTACAAATGGTGCCAAGGTCAGATACACTTGCTGTGGTAG
AAAAGGAAATAGTGACAAGTTTTACGCTCCAAGGAGTATTCTAACCAACTTGTCATTGAA
TATCCTCAGGCATCAACAACTTGCAGGATGTGTGGGAGACTGGTGAGGGAGAATGCAACG
TGATGCTGGAGTCTCGCTTCGAAAAGATGTACGAGAAGATCGACCTGACCCTGCTCAACA
GGCTGCTTCGTCTTATTGTTGACCATAACATTGCTGATTACATGACGGCCAAGAACAACG
TCGTCATCAACTACAAGGTGCTTATTCAAACCTTTTTTATGTGTGTGTGTGTCTGTGGCT
ATATGTTTTATTACATGGTTCTTATTTTAACGGTTATTGGCTTGTGATAAAATGGTTCTC
TTGTAATGTGGTTTCTAGGATATGAACCACACCAACTCCTATGGAATCATCAGGGGACTC
CAGTTTGCCTCATTCATCGTGCAGTACTACGGTCTTGTGATGGACCTGCTGGTGCTGGGT
CTGCACCGCGCCAGTGAAATGGCTGGACCGCCGCAGATGCCCAACGACTTCCTCAGTTTC
CAAGACACTTCCACAGAGTCTGCCCACCCGATCAGACTGTACTGCCGCTACATCGATCGC
ATCCACATCTTCTTCAGGTTGGCTTTCTGGACGTATTATGATGGTCAAACTATGCCTGAG
GGGGGAAATAAAGGATTTTATTATTTCAGTTGAAAGTAAAGTAAGTTTCATGTTTTAACC
AGGTTCTCAGCTGATGATGCCAGGGACTTGATTCAGCGGTACCTGACTGAGCACCCGGAT
CCCAACAATGAAAATATTGTTGGCTATAACAACAAGAAGTGCTGGCCACGTGACGCTCGC
ATGCGACTGATGAAGCACGATGTCAACCTGTAGGTGTTTCTTCCAGGACTTAATTCCGTC
CGTCTTTATTGTTTTTCTGAGGCTTTTTTCTTCCCTCTGTCATTGGCCTCACAGGGGCCG
AGCTGTTTTCTGGGACATTAAGAATCGTCTACCCAGGTCTGTGACTACCGTGCAGTGGGA
GAACAGCTTTGTTTCAGTCTACAGCAAAGACAATCCCAACCTGCTCTTCAACATGTGTGG
CTTTGAGTGCCGCATATTGCCAAAGTGTCGCACGAGCTATGAGGAGTTTACCCACAAGGA
TGGTGTGTGGAACCTGCAGAATGAGGTAAGAGGTTGACGCTAAACTGTTGTTGCTAATGG
ATTATTTTGAGTTTCTTTGGTTAGTAAATTTTGTTTTACCTGTTTTTTAACCGTCAAGGT
AACAAAGGAGAGGACAGCACAGTGTTTCCTGCGTGTTGATGATGAATCAATGCAGCGGTT
CCACAACAGAGTACGTCAAATCCTGATGGCCTCTGGATCCACTACGTTTACCAAGGTCAG
CAGACATTTTTTTTTTCTCCAAACGTCTTTAAACTGTAGCGTTTAATAAGCTAATGGATC
AAGAGTGATGGACTGTCATTGATTTTCTAAATCTGCCTCTACCCTCAGATTGTAAACAAA
TGGAACACTGCCCTGATTGGCTTGATGACTTACTTCCGGGAGGCTGTGGTGAATACACAG
GAGCTCCTAGACTTGCTTGTGAAGTGTGAAAACAAGATCCAGACACGTATCAAGATCGGT
CTGAACTCCAAAATGCCTAGCCGCTTCCCACCTGTGGTCTTCTATACACCTAAAGAGTTG
GGTGGCCTTGGCATGTTGTCCATGGGTCACGTACTTATTCCACAGTCAGATTTGCGGTAA
GTCAAAGGGTCGACTTAGTTCCACGTTGAATTCCCATCCCGAATGCGTTGCAACCGACAG
GCCTTTAACTTCTCTCTATCATCCAGGTGGTCCAAGCAGACAGATGTTGGCATCACCCAT
TTCCGATCTGGAATGAGCCACGAGGAAGACCAACTGATTCCTAACTTGTACAGATACATT
CAGCCATGGGAAAGTGAATTCATTGATTCCCAGAGAGTCTGGGCAGAATATGCCCTCAAA
AGACAGGAGGCCATTGCCCAGAACAGGTAATAAACTGGTGAAAGAATGGGTGGCACATTA
ACAAATGATTATTTATCTTCTTTTTTTTTTTAATCGACTGCATTTAAACAAGGGCTTAAT
GGTGTGTTCTGTGCTTCAGGCGACTGACCCTTGAAGATTTGGAGGACTCGTGGGACAGAG
GAATCCCCCGAATCAACACGCTGTTCCAGAAAGACAGACACACACTGGCCTATGATAAAG
GCTGGAGAGTCAGGACCGATTTCAAACAGTATCAGGTATAATTGCATTCAGTCGACGTTT
ATTCATACGTAGTGTTTGATAACTGTAACTTGCACGTCTGTACGCAAAAGCGTACGAGTT
TTTAACCGCTGTATCACTTCTTGATAATCACACAATCACTTTCCTAAATATATAATCTGC
ACTTGTCAGGAGGTTGCAAGCAGCGCTAATGTTAAGTTTTGTTTGGTTACAGGTGCTGAA
ACAGAATCCATTCTGGTGGACTCACCAGAGACACGATGGCAAACTTTGGAATCTGAACAA
CTACCGCACAGATATGATCCAGGCCCCTGGGGGGTGTGGAGGGCATCCTCGAGCACACCC
TCTTCAAAGGCACTTACTTCCCCACCTGGGAGGGTCTCTTCTGGTGAGTGCACTTCCATG
CGATGATAAGATTTCTAACTAAGGATTCATATTTAGTTTCCCAGATTTGAAGTTTACTTT
TCTGTGGCGTTTAGTAAAAAATCTGAGTCTGTCTCTAAATCTTGAAAACTTTGGTGTTGG
ACTATAGGGAAAAGGCCAGTGGCTTTGAGGAGTCCATGAAATGGAAGAAACTGACCAATG
CCCAGAGGTCTGGTCTCAACCAAATCCCCAACCGTCGTTTCACACTGTGGTGGTCACCGA
CCATCAACAGAGCCAACGTCAGTACAACTTTTGGTTCACGCGTCTCAGATATTTTATACT
GCTGCTGGAGGGCAAAAATTAAGATCAATAACACCTGTTCTCCACTGTTAAGGTCTATGT
GGGTTTCCAAGTGCAGCTTGATCTGACTGGAATCTTCATGCATGGAAAGATCCCCACGCT
GAAGATCTCCCTCATTCAGATCTTTAGAGCCCACTTGTGGCAGAAGATTCACGAGAGCAT
CGTCATGGATCTGTGTCAGGTTGGTGCCACGTGTTGCCCAACCACCAACAGATACTTCTG
GAGTTGCCTCCCATGTCGGTTTTGTTACTAAATACTATTTGTTTTACAGGTGTTTGATCA
GGAGCTCGATGCTCTTGAGATTGAGACGGTACAGAAGGAGACCATCCATCCCAGGAAGTC
CTACAAGATGAACTCGTCTTGTGCGGACATTCTCCTCTTTGCGTCCTACAAGTGGAACGT
CTCCCGGCCATCTCTGCTCGCCGACTCCAAGTATGATTTCATTATTTCGTTTTTACCAAA
CACATGTAATGTTTGCACAGATGAGATTGATCCAGGTGTTGTTGCGTTGCTCTTTTCATT
GCTTATTTATTTATTTTTTTAAATTTTTCTTGCAGGGACGTGATGGACAGCACCACCACA
CAGAAGTACTGGATTGACATTCAGTTGCGCTGGGGTGATTACGATTCCCACGACATCGAG
CGCTACGCCAGGGCCAAGTTCCTCGACTACACCACAGACAACATGAGCATCTACCCCTCA
CCCACCGGGGTGCTGATTGCCATCGACTTGGCTTACAACCTTCACAGGTGTGTTGGAGCA
AATTCAGCAGCAGGGTCTTTGACTTGGTTCGCTCAAAGCCTGCGAGTCGGCTAAAAGCCA
GTCGCTCAAATGTGTTTCTCTTTGCAGTGCCTATGGCAACTGGTTCCCTGGAAGCAAGCC
TCTGATCCAGCAGGCCATGGCTAAGATCATGAAGGCCAACCCCGCCCTGTATGTGCTCAG
GGAGCGCATCCGCAAAGGCTTGCAGCTGTACTCCTCTGAGCCCACCGAGCCCTACCTGTC
CTCGCAGAACTACGGAGAACTCTTCTCCAACCAGATTATCTGGTTTGTGGATGACACCAA
TGTGTACCGAGTCACCATTCACAAGGTGCGCGTTGTTGTTCTTTAGCAAAACCCTAAAAA
AGTTGTCGAGAATTATTCTTTCAGGTCACTTAATCGCGAATACCTCTCATTTATTTCAGA
CATTTGAGGGGAACTTGACCACGAAGCCAATCAACGGGGCCATTTTTATCTTCAACCCAA
GGACTGGTCAACTCTTCCTCAAGATCATTCACACGTCTGTGTGGGCCGGTCAGAAGCGTC
TGGGACAGGTCCTGCTCCATCTTCAATCATTTTTAGAAAAACCTTTGCAACAGACACCTA
TTTGTTGTTTTGTTTTTAGTACAAACGCCGCCTCTTGACATCTACCATTTGTCTCTGCAG
CTGGCCAAATGGAAGACGGCCGAAGAAGTTGCCGCCCTGATCCGCTCGCTGCCAGTGGAG
GAGCAGCCCAAGCAGATCATCGTTACCAGGAAGGGCATGTTGGACCCTCTGGAGGTGAGA
GGTTTCAGTGCCACTTAATAAAAGTGAAGAAGAAGAAGAAGGTGTGGATCATCAAAGCTA
AGCCGAACTCCTCTTTACAACCTTGTTGTTGCTGCGCAGGTTCACCTGTTGGACTTCCCC
AACATTGTGATCAAAGGGTCCGAGTTGCAGCTGCCCTTCCAGGCCTGCCTGAAGGTGGAG
AAGTTTGGAGATCTCATCTTGAAGGCAACAGAGCCTCAGATGGTGCTCTTCAATCTTTAT
GACGATTGGCTCAAGACCATCTCCTCTTACACAGTGAGTTTGACTTTAACCCCACCAGTA
AGCGAAGGAGATTTAAAAAATGGCTCAGCACCAGGCTGTGCTTGTGTCGGAATATCGAGT
TATTCTTCTCTCTTAATAGTTTGGGCTTTGTTGTTCTGTTCTGTTTTTTTTTTAGGCCTT
CTCAAGGCTTATCCTGATCCTCAGAGCCCTTCATGTGAACAATGATCGTGCAAAGGTGAT
CCTGAAACCTGACAAGACAACCATCACCGAGCCCCATCACATCTGGCCCACACTCACCGA
TGAGGAATGGATCAAGGTCGAGGTGCAGCTCAAGGATCTCATCCTGGCAGATTATGGTAA
AAAGAACAAGTAAGTCATCTGCCAGGTTCTGTTTCTGGATTTATTGTTTTTTTAATTAAA
CAAAATGGAGCCATTTTAAAACTCTCTTGTTCTCGCCTCCTTCCCCAGCGTGAACGTGGC
CTCTCTGACCCAGTCTGAGATCCGTGACATCATCCTGGGAATGGAGATCTCGGCTCCATC
CCAGCAGCGTCAGCAGATCGCTGAGATCGAGAAGCAGACTAAAGAGCAGTCGCAGCTCAC
AGCCACGCAGACCCGAACGGTGAACAAGCACGGCGACGAGATCATCACCTCCACCACCTC
AAACTACGAGACCCAGACTTTCTCCTCCAAGACTGAATGGAGAGTCAGGTAGGCTGACCC
TTTTTATGAACTTCAGACAGAGCTGAAGGTTTTTTTTAGAGGGTTTTAGAATAAGATATT
AGCTTTAGCGCTAACAATGTGCTGTGCTCATCATGCAGAGCCATATCTGCTGCTAATCTC
CACCTCCGGACCAACCACATCTACGTCTCATCTGATGACATCAAGGAGACGGGATACACG
TACATCCTGCCCAAGAACGTCCTCAAGAAGTTCATTTGCATCTCAGATCTGCGAGCTCAG
GTATGTGAGGGGGCGTTTATCGTTCCAGGTCAACCTCCCTGAATGAATCTGGTGGTTGTT
ATCTTTTTAATCATCCTCCTTGAATCTATCCTATAATGTCCTTCTCTCGGTCTGGTTCTT
CCAGATTGCAGGCTACCTGTATGGCACCAGTCCACCAGACAACCCTCAGGTGAAGGAGAT
CCGTTGCATCGTTATGGTGCCGCAGTGGGGAACCCACCAGACCGTCCACCTGCCCAATCA
GCTGCCCGGTCACGAATACCTTAAAGTAAGACGGCCCACGACACAGACGAGCACAGACTA
GTCGTTCGGTCCGGCTATTTTATTTTCCTTGTCCGTACCAGGAAATGGAGCCCCTGGGTT
GGATCCACACGCAGCCCAACGAGTCCCCCCAGCTTTCCCCGCAGGACGTCACCACACACG
CCAAGGTCATGGCCGACAACCCCTCCTGGGACGGAGAGAAGACCATCATCATCACCTGCA
GGGTGGTGCCGCAGCAAGCCGGCCCATGCCGCGCGGGTTCAGATGTCACCTGTGGGGCGA
ACGCCACTAAAACCTGATTTGATTTGTGCTGGTCAGCTTCACGCCGGGATCCTGCACACT
CACAGCCTACAAACTGACACCCAGCGGCTACGAGTGGGGTCGGCAGAACACAGACAAGGG
CAACAACCCCAAAGGCTACCTGCCGTCCCACTACGAGAGAGTGCAGATGCTGCTGTCTGA
TCGCTTCCTGGGCTTCTTCATGGTTCCTGGGCAGGGTTCCTGGAACTATAACTTCATGGG
TTAGTAGATTTAAGACCGTATTTGTGTTTGTATGTCCTGCTTTTTGGGTGACCACGTTTG
TAAATGAAACTACGCTCAGGGCGTGCAATACAACGAGGAATTTCCGGACCGTGAGCTTCC
CTAAGTGTTGGGTCCTTTGTCTCGCTCCAGGTGTGCGCCACGACCCCAACATGAAGTACG
ATTTACAGCTGGCCAATCCCAAGGAGTTCTACCACGAAGTCCACCGCCCCTCGCACTTCC
TGAACTTCGCCTCGCTGCAGGAGGGAGAGATCTACAACGCGGACCGCGAGGACATGTACG
CCTGAGCGCGCGCTGCACACACCGACGGGCGCGCACGGCGAAGCATGTAGGAACCAGTCC
AACACACAGCCCTTGTAATATTTCTACCAAACCCGGAACTGATGTTTTTGACCTGTTTTG
AAAAAGGTTCAGGATATTTTAGAAGGTTTTTTTAGGGTGTTTCTTTTCTGCAAATGTTCA
GTTTGTTGTAGCCATCTACACGTTTCCATTTTGTGTGTAGTTTCGTAAAAACAGTGCTCC
TGTGTAAAATTTCACTTTAAAAGGTTAAGATTTCTTCACATGACCCCGTTTAAGAATCAT
GAAATCCAAAGTTGTATTTACGTGCCCGTCATGCTCTTGTAATGATGTGCTGTACACCCT
GTAACAGATCAACCTGGGATTAAATAAAGACTTGTGTTTTTTTTACAAATGTCATAGGCG
ACCTGGTGTTTTTCTGCTATTATAAAACTATAAAGCGCTTCTTTATGGCGGAGGGGAACT
TCACATGTGCTCATTTCCTCATCTAAAGAGGGCAGATGTGCACCGATCCCGGCCTGGCCT
GATTTACAGGGCCGGATAGAGGTCAGCGCTGGCGCTGAAACCCAGATTTACCGCTCCGGC
GCGTCCATGATCGACCTGACAGGCGCGTCGGTCACAAGTAGGAGGATCCAGAGGAAACCA
CAACATGACTGGCGTTCCCAACAGCCAGATCGCTCCCGCGCTGCTCATTTGGGTGCGTGG
AGTTCTTTAACCGCTTCCCTCCTGTCTTTTAGTTGCGCTTTATGAGGATCACGTTGTCAG
GAAACCACCGGCTCTCGCTTTCGCTATCGGCTATGGGAGCGAGCGACGCGCCGTAGCCAT
GGACGAACCCGAGCCGCGCTCCGACGGCTGCTGGGACGCATCCTGCTCGGCTCTGACCGT
GGACGACGTGTACGACATCGCCAAAGCCATCGGCACCGACGTGGAGAGGCTGGTCGACAG
CTGCGGGAAGGACAGCGTCGCCGCGCTGGTGGGGAAGACGGTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 1193..1370, 1492..1656, 1803..2021, 2108..2320, 2579..2704, 2819..2924, 3186..3376, 3525..3644, 3757..3949, 4473..4513, 4544..4751, 4979..5185, 5549..5712, 5821..5947, 6084..6276, 6369..6556, 6678..6916, 7022..7168, 7254..7464, 7558..7674, 7788..8035, 8126..8305, 8419..8554, 8752..8922, 9067..9196, 9292..9438, 9529..9689, 9815..10006, 10107..10344, 10439..10567, 10680..10793, 10899..11072, 11215..11408, 11508..11747, 11858..11999, 12124..12264, 12341..12480, 12576..12778, 12930..13084
1001..1109, 1193..1370, 1492..1656, 1803..2021, 2108..2320, 2579..2704, 2819..2924, 3186..3376, 3525..3644, 3757..3949, 4473..4513, 4544..4751, 4979..5185, 5549..5712, 5821..5947, 6084..6276, 6369..6556, 6678..6916, 7022..7168, 7254..7464, 7558..7674, 7788..8035, 8126..8305, 8419..8554, 8752..8922, 9067..9196, 9292..9438, 9529..9689, 9815..10006, 10107..10344, 10439..10567, 10680..10793, 10899..11072, 11215..11408, 11508..11747, 11858..11999, 12124..12264, 12341..12480, 12576..12778, 12930..13084
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved