Tetraodon_nigroviridis Locus Poly:SNORD59
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD59
Tetraodon_nigroviridis
Poly:SNORD59
9
SNORD59, SNORD59
1103..1175, 2001..2075
3075
CGGTTGAGGCCGCCAAGCCTGTAGAAAAGGCCAAAGCTGCTCCGGTTGAGGCTGCCAAG
CCTGTAGAAAAGGCCAAAGCGGCTCCGGTTGAGGCCGCCAAGCCTGTAGAAAAGGCCAAA
GCGGCTCCGGTTGAGGCCGCCAAGCCTGTAGAAAAGGCCAAAGCGGCGCCGGTTGAGGCC
GCCAAGCCTGTAGAAAAGGCCAAAGCGGCTCCGGTTGAGGCCGCCAAGCCTGTAGAAAAG
GCCAAAGCGGCTCCGGTTGAGGTCGCCAAGCCTGTAGAAAAGGCCAAAGCGGCGCCGGTT
GAGGCCGCCAAGCCTGTAGAAAAGGCCAAAGCTGCTCCTGGAGAGGCTGCCAAGCCAGCA
AAAAAGGCTAAAGCTGCTGTGGTTGAGGCAGAAAGGGCCAAAGCCGCCGCAATGGAGACC
ACCAAGCCTCTAGAAAAGGCCAACCCTGTTCCTGTTGAGCCTATTGTTCCTGCTCCAGCC
CCACGTAAACTTACATTTGCTGAAGCTGTTTCAAAACCTGCCCCTGAAGTTGAGGTAGTT
GGTACAAAACCTTCTGAAGCCGTTTCTTCACCCAAACCTGTCCCTCCATCTGTTAAAACC
CCAGCCACACTGGAGACTGTGATCAACAATAATAAGGGTATTCACTTTCATTTTCTTCTG
TGTGAACAGCTATCATCTTTAGAGCTGCTCTTAATCTTTTTTTTTTTTTCCAATGTAGTC
TAATTAGCATATTCCTTTCAAAAATGCTTTTTATTGAAACGTACAAACGTAAGTTGTTTT
TTTATAATTGAGTCTTTGACATTGGGTGTTCAGGTAGTTATGATGTGAAAGAAAAGTTAA
TAGATTAATGTTATCTTGATAATGGGAATCATGGGTTTTATTTTAAACTATTTCACCTTT
TTCTATTTTACAGGATTAATCAAACTTTTTTTATAATTCAAAAGTATCTAAAACATATTT
GAATGTTGTTGCTCTAGGGTCCGGCACGGAGTCAGACAGTGACGACTCTGTCCCAGAGCT
GGAAGAACAGGATTCCACACAGACGCAGACACAGCAGGCGCAGGTAAGCGTTTCATCATT
TAAGCAGCAATGAAGCTCGCGTCTCTTCTGTGATGATCAACACATTGACTTTCGTTCTTC
TGAGTCTACTGAAGCCACCTCGTTGTCCTGAGATGATGGAGGGTTCACACATATTTAAAC
TTGTCGTGTCTGCATTTGGTGGTAAAAGATGAATTTGCTTTCTAGCTGGCAGCAGCTGCT
GAGATTGATGAAGAACCCGTCAGCAAAGCCAAACAGAGCCGCAGCGAAAAGAAGGCAAGA
AAGGTGATGGTCATTTTTTCTGTTTTACCAATATGTGTGATGGGCAAAGCAATTAATTTC
TTTGATTTCTTAAAGGCAATGTCGAAGCTCGGGCTCCGGCAGGTAACAGGGGTCACACGG
GTCACAATTCGCAAGTCAAAGAACATCTTGTTCGTCATTACCAAGCCAGACGTCTACAAG
AGCCCGGCTTCAGACACATACATCGTCTTTGGTGAAGCTAAGGTTTGTGGCAAACCCCTT
ACCTGGCCCAGAAAGATACCTGTATATGAAATATCAGTCCGTCCATGTGTGGATTCTGCA
TTTTGTTCTCTAGATCGAAGATCTTTCCCAACAAGCTCAGCTGGCTGCTGCAGAGAAGTT
CAAGGTCCAGGGAGAAGCCGTATCCAGCATCCAGGAAAACACACAGACGCCAACAGTACA
GGAGGAGAGCGAAGAAGAGGAGGTGCGATGGTGTCGGCTTAGAGACAGACAGACATGCAG
AGTGTTTAGAGCATACTCATTCTGATTGTCGCTAGGTTGATGAGATGGGCGTCGAGGTTA
AGGACATCGAGCTGGTCATGTCACAAGCCAACGTGTCGCGGGCGAAGGCAGTACGCGCCC
TGAAGAACAACAACAACGACATCGTCAACGCCATCATGGTAAGGTCTCATTTTCTGAAGG
CTCGTTGCCCTGGACGACAGCTCTTCACTGAGGATCTCAACTTTGACTTTCGTTCTTCTG
AGTTTCATGAAGCTGATGTTTTTCACACTGAGAAGAGCAGTTTGTCCTATTTTTGTGGAT
AAATTTGTAACAAATATACTTAAGCATATCTTTGTGCTCTTTTGCAGGAATTGACGATGT
AACAGGACCCTGAAGAAGAGGGGTGTAGGAAAGGTTGCTGATTTGACATTTATACAATTT
ATGATACCCAAGATGGAAATAAAGTTGTGGCTTGATAAATGAAATGATATATTTTTTGGC
TTTTCTGCACTCAATTTGAAAAACTGGGCAATTTCAACCTTTTTAAACTGGGAAGACACT
AAAAGATGTCAACTACTGGTTCCAAGCATTAACTTAGTAGAAATATGTCAAGTATTTGTA
GCCTCCTGGGGGGTGGGGGTGCTTCCATGACATTTTGAGTTTGTGAGTTTATTTCACCAT
GGTTTGCTGCTCGATTGTACTGACACGGGTGGGTCTGTCAGTGCTGCGCTGGGGAAAAAG
TTCTGTAAAAAACCTTTTAATTAAAGCTCTTTCCCCACAATTGTCTTTAAAATGTTTACA
TTCTCCTGGGAGGATCAGGTCGGTCAGACAGCGCTCAGCTCTGGTTTTTGTGGCGTCTTC
TGTGGGAAAAAGTTGGTCTTGAGTGCAACAAAGCCGTCCAGTCTGATGTTCATCACTGAA
AACCTGGACCAAAGCTCCTACAGATGTGCAAGGGTTGATCACAGGAACAGAAGCCCCAGG
ATGAAGGTTCAACCAGACGTTCTGTTGACGGTGGAGCTCCTGGAATAAAAACGGATGGAG
TCGCACTGGGGAGAAGCAGTAGATGTTTAGGATGAGGTCCTGGGTGCAGTCAGGTGACAA
CACCCTAGAGATTGGATGAATATATGTATCCCATGTTTATTTTACTAGAAAATTAATATT
CCGAGCAGAATACTTTGAGGTCTAAATAGGCAAATATTACTATCAAGTAATGAAAACAGT
AATATTAATAGTTATATAACTGGTTGTGTTACTTATAATAATCAAACTGCTACCACGGGG
GCCTAAATCCGTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved