Tetraodon_nigroviridis Locus uba1
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis uba1
Tetraodon_nigroviridis
uba1
9
snoU6-53
7241..7357
8960
ATCCTCGCCAAATCACTTAACTAATTAGAGCCAGGTAACCGCTTTAACTGCGTTCCCCT
GGGTTGGTCCGTCCACTCGAGCCTCCGTTTCCGAACCTTTAAACGGGATCGTTAATGTTT
CTGCATGTAGTTGTGGACAGGAGCTACAGCACCGCTGCTAACCCGGTAACTGGGCTATGC
TGTATCATGCCGGATGCTTTCGCTTTAGACAACCTCGAATAGGGCTATAGTAAAGTAATA
TATATCTATATTTTTCAATTACTGACTCACATTCGGCTTTTTGAGCGACCGCTGTCGAAC
GAAACTGAAGTAGCTTTTACAAATGGCTCACTTTCTGGTCGTGGGCAGCGGTGATTTGGC
TGCATCGAATGCGGAAATTGTTGCCGTTTGCATAGGGAACGACTTCGCCGTTCTACGGCC
GCCTTCACCTCCACTTTGATTAGTCTGGATTAATTATTATACTGCGTTTATCTCTTTGTT
CCTAAAATCGCCCTGTCTTTATTGTCCCGGCGTCATTGTCCACCTGGACGCCGAGGCGTT
GTTCACTTTACCGCAGTGAAGTTTTAATGATTCAGCTCTTTTCGTAGAAGAATGCTGTTC
GTAACTGGTAAAATAAACAATGGAAGTACATAAACAAGCCTGCATTGATTCTGGCTGTGG
ATGGGAGATAATGCAGTTATTCATGGCGTTTCCCAGGGAGTTGGTTTTCTACCAGATTTG
TGTTTTGGGTTGTGGCCAGCCCAGCTGTCCCTTGACTAGAAATCCTCTGACATCCAGAGA
TTCTCTACCATTTGGTCTGCTCTCTCATCCTTAGGAAACCAAAACCTCCAATTATTTATA
GCAGCCTGTTTCGCCCCAGTGAATGATTGGTCTTATTAAAGAGTTTAGTTCAATCTTTAA
ATACATTTTCTATTTGAATGAAAATTACTCTTGTAAATGTGAGTGAACACAGATTTGTCT
GTCTTTGACTGTGACGGCTCTAACGGATTGTCTGTCTATAGATGTCCAGCTCGCCGCTGT
CCAAGAAGCGTCGCTTGTCAGGAACAGAGACGAAGACGGGATCCCACTGCTCCTCCTCAA
ACTCTGTCAAAACTGATCTGTCCCACACACCTGCCAACGTAGGCGTAAAACAGACGCTGT
GTGATATTTTTATAAACTTGGAATATTGTGCTAAGAAGATCTTTTGTTTCTCTTTAGGGC
ATGGCTAAGAATGGCAGTGATGCTGAGATTGATGAAGGCCTGTACTCTAGACAGCTGTGA
GTTGAATATTAGAACAATTAGCATAAAAAAGACATATATTGGCAGTTGTTTTGAGGTTTA
TGCACAGGGCACCTATGCTAATGTTTTTCTATCCCTGTAGTTACGTGTTGGGCCACGATG
CGATGAAACGCATGCAGAACTCCAATGTCCTCATTTCTGGTATGAAAGGTCTCGGAGTGG
AGATTGCTAAGAATGTCATCCTGGGAGGAGTTAAAAGTGTTACTGTACACGACGAGGGTG
CTGCCGAATGGAAAGATCTCTCTTCTCAGGTGTGTAAAAACAGAAGACAAATATAAATAA
TTCTGTTTTTGAAAACCCACTTTTTTCTCCTCGTGTTTGACATGACTGGTCTATTATTGG
ATTTTTGATTTGTTCTTTGTATAAAATTCCTTTATCTAGTGTTGGGTTCTATGGCTTATT
GTTGTTGCTGCTGACCAAAAACAGGATTGCAGCCACCCCCACCCTAGGTACCATCGACTG
ACCCAGATTTATCAGTGGCTGGCGTCTAGGTTGTAATTATAGTGGAGCCAGTACCTGTTT
TAGAACATGGTTATCATTGGGCAACTGTTTATTCTTATCAGCGTCAGACCTAAAAACCTT
ATATTGTCTTCTCTGGTCAGTTTGAACTCCTTTTCTAAATGAAAAAAGATTAGTAGCTGC
TTTGTGTGTTGATTTGGGCTCTTTTCCTGAATTTTTTTTTTTATTTATTTAAGCCAATTT
ATTTTATCAGAAAAACTCCAGCCAGAAAGGTGAAAAAAATGCCTAAATTGTGCTAGTTTT
CCCTTTTTTATAATCTTTTTCTCTATTCAGTTTTACCTTCGTGAAGAGGATTTGGGAAAA
AACCGAGCAGAAGTGAGTCAGACCCGTCTAGCTGAGCTCAACAACTATGTACCCGTGACA
GCTTACACCGGAGCCCTCACCGAGGACTACCTGACCAAGTTCCAGGTACAACTGACCCCC
TGCTCCGTCAGTGACCAACAAAATATTGAATAAGAGTTTTCATGCTTTGTTAACATTTGT
AAACGTAATTAACGTGTTTTCTGTGTATTGTAGGTAGTAGTGCTAACTAACTCCACACTA
GATGAGCAGCAGCATCTGGGGGAGTTTTGCCACAGCAAAGGCATAAAGCTGATTGTTACA
GATACACGTGGTCTGTTTGGGTATGTCATACTTCTTAATTTAGCTTTATTGTACATCTGT
GTGTCCTCTCAGTAATTAGCCTAAATTTCACCTTCAATTGTTTTGCAGCCAGGTTTTTTG
TGACTTCGGTGAGGAGATGATTGTGTACGACACCAATGGAGAGCAGCCGTTAAGTGCCAT
GATTTCTATGATTACTAAGGTTAGTTGCTTTTTTAGATAAACTGGCATTTTCACATTAAA
TTATACTTTTATAATAAAGAATAAGAATCCAGTATTCTCACTAATTTGTTGTTGTGTCTT
GTTCAGGACAATCCTGGGGTTGTGACGTGTCTGGATGAGGCTCGTCATGGTTTTGAGAGT
GGGGATTATGTCACTTTCACAGAGATTCAGGGTATGCTGGAGCTAAATGGCTGCCAGCCA
GTAGAAATTAAAGTTCTGGGTAAGTTTTGATTTTGACAAAATTAAGTTGATTTGCTCATG
ACTGTCCTAAGTTGACATTCATCCTCTTTTCAGGCCCTTACACCTTCAGCATTTGTGACA
CCACAGGCTTTACAGATTATGTCAGAGGAGGTATAGTCTCCCAAGTAAAGATCCCGAAGA
AGATCAGTTTTGTAAGTTACAGGGGCTACTGTTTATTGCCAGTATTTTCAAATTGTTATT
TAATGTTGTCTTGTATCTCTGCTGTACAAATACATTATTATTCTATATTTTTCTTTGATT
GTCTGAAACTGCAGCATTAAAATACATTCTTCAGATATATTCTCCTTGTCTTCCCACATA
GAAATCATTTTCTTCATCTATGGCCGAGCCAGAATTCCAGATGACAGACTTTGCTAAATT
CGATCGTCCAGCACAGTTGCATGTCAGCTTTCAGGCAATCCATGCTTTCCAGAAGAAACA
CGGTCATCTTCCTTCACCTTGGAGTCAGGTAAATTCCTTCACTTTAACCTTATTTTGGGC
TGTTGAGTGATTATAAAATGTGACATTAATTACAGCAGCTATAGCTGCAACGATTCGCCA
CCCAGCGCATTTCATTAACTGCCCTGTAAATTCAAATATGCTGTTGCTGTCATTGCAGTA
ATGGTATCATAAAAAGTGAATAAATTAACAGTCACTTCATTTACCACAGTTAAAAAAATG
AATGTATTCCTTTAAAAATAAAAATGTAAGCCATTTATTTGGTTGGCCCCAAAATGACAT
TGCTGATTATTGAGTACAACAGAAAAAACCTACTTCTCCTTGAGATTGAGGCTCTGCAGT
AACAGTGCTTTATAAAGGTGGCTATATTGGCTCAGCTGTTGGTAAAATGCTGAGCTGTGT
GTGTTGCAGGCTGATGGGGAGGAATTTGTGGCACTGGCCAAAGACGTGAATGCCAGTCTG
ACAGGGTCAGCCAAAGTGGAAGAGCTGGATGAAGCACTTTTGAAGAAGTTGGCATATGTT
TGTGCTGGCGACCTGGCACCCATAAATGCTTTCATTGGAGGTTTGGCTGCACAGGAGGTG
ATGAAGGTCAGTGGTCATCTTTTATGTAAAAAGTGGGGTGGGGGCTGTGTGGTAAATGTT
TCCTGTGTGTTTTTAAATGTTCTTTATCTTTTCAGGCTTGCACTGGGAAATTTATGCCAA
TTAAGCAGTGGTTATATTTTGATGCCTTGGAGTGCCTGTCAGAAGAAGATGATTTCATGC
TCACAGAGGAAGAGTGCGCTCCTGTGAGTTCCTCTGTCAACACAATTGCTAAACTTGGAT
ATACAAAGGGGATGGTAAATCCTTTTTTCCTCTTTCAGAGAAACTGCCGTTATGATGGTC
AGATTGCAGTGTTTGGCAAAAATGTGCAGGAAATGCTGGCCAAACAGCGCTACTTCTTGG
TAAGTAGAACAATTAAAAACTCTAGCAATGACTGATTATACTTTTCACTCAAGTGCTTGA
CTCAACAACAGAAGTGTCACGATTTTTCAGGTTGGGGCTGGTGCCATCGGCTGCGAGTTG
ATGAAAAACTTTGCCATGATTGGCCTGGCAGCTGGGGAGGGAGAAGTTATTGTGACAGAC
ATGGACACTATAGAAAAGTCAAACCTCAACCGACAGTTTCTCTTCAGACCATCAGATGTG
ACGGTCAGTATGAGCTTTAATCGCGTCTGCAAATATGAAGTAAGCTCAAAGCTGTGCATG
AAGCAATTACTCTTAATTTTTGTGTTTTAAGCTCCTGTTTGTCACTGAATGTTTGTGTCC
TGTACTGTAATACTAACATGGGAAACAGGATGCCTGCAGGTCTAAAACCTCGTTTTTTTT
CCTGCTGATCTTAAAAAAAAAGGCATACTTTATTTCTGTATTTTTCTATTTCTGGTGACC
ATGTTGTATTTTGATGTAAGATGCCAGGAATAGCTTGAATCTTTTGTGTGATAACAGAAA
ATGAAAAGCGACACCGCAGCTATGGCTGTAAAGCAGATGAATCCTGCCCTCAAGATAACC
GCTCACCAGAACAGGGTGGGTCCCGACACGGAGAGGATCTACAACGACGACTTCTTTGAA
AGCCTGGACGGAGTCACTAATGCACTTGACAATGTTGATGCACGTAAGAGCAACAGAACT
TTGTCAGAACATTGTCCAAATGTGTTTCCCATTCAAAAGCCTAAAATAAACATGTCTTCG
GTGTGTCTTCCGCTTGTCTGTGCAGGTATGTACATGGATCGGAGATGTGTGTATTACCGC
AAACCATTATTGGAGTCTGGTACTCTTGGCACTAAAGGCAATGTCCAGGTTGTGATCCCC
TTCCTCACGGAGTCTTATAGCTCCAGTCAAGACCCACCTGAAAAGTCCATCCCCATCTGT
ACCCTCAAGAACTTTCCCAATGCCATTGAACATACACTGCAGGTCAGTCAACACTCCCGA
GCACCACCTGCAGTACTGGTCCTTTCTGGACTTTTTAGGCAAATTTTTAACATCACAAGA
GCATTTCTTTAGAGCTAAAAGAGTCACTGCAACTCTTAAGCATTTCTGTGTTGATTGTCG
CGTGTAAAAGATCTTAAAGCAGTGGTTTGCTTTTTCTTTTAGTGGGCTCGTGATGAGTTC
GAAGGACTGTTCAAACAACCACCGGAGAATGCCATGCAGTATCTCACGTAAGTAAAACAC
TTAACTGCATTTGCAATGAGATCCGTTTACTCTGAGGTAACAAATGACAACCCAAAATAT
TCACATTTATGAGCTCAGGATGTTTCTTTATTGATGTGTTATAAGGAGTTTGTTCTCTAT
CGCCGCAGGGACCCAAAGTTCATGGAACGCACTCTGAAACTTCCTGGAGCTCAGCCTGTT
GAGGTGCTGGAGGCAGTTTACAAGAGTCTGGTCACAGACTGTCCCCATAGCTGGGCTGAC
TGTGTCGCCTGGGCTCGCAACCACTGGCAGTGCCAGTACAACAATAACATTCGTCAGCTG
CTACACAACTTCCCCCCAGATCAGGTACCTGCTGCGCTTACTGCGGAGTCATTAACATGT
TTTAATGCTTCCTGGTTCCCTGATGAATGTGTACTTTTTGTTCTCTTATTACTAAAGCTA
AAGAATCTGTGATTACTGATCGCCTGAAACTTGTTGGGTCCAGTTTTCTTTTTTGGTTTA
TCGTGTAACTCTTAACTTCCAGACACAATCTTTTTTGTGAAACTATTATAATTCAAGGAC
TTCCGTTTTATTTAAATTAACACAATAGATTAATAAATCGATTCAGCACCTGTTATATTG
CATCTGTAATGCTTTTTTCCCCCCTTTCTTTTAGCTTACTAGCTCTGGCGCCCCCTTCTG
GTCTGGCCCAAAGAGATGTCCTCACCCTCTAGAATTTAGCACGAGTAATGTAAGCATTTT
TGCCATGTGTACTTAAATCCGTTTGCTGCGATATTTGAGCTTTTAAAGAAAGTGCTTACT
TTTTTGATTTGGTTCTCTCGCAGGAGCTGCACATGGATTATGTTGTGGCAGCTGCCAACC
TCTTTGCTCAGACGTTTGGCGTGCAAGGCAGCACAGATCGAGCCGGCGTAATCAAGATTT
TACAAGATGTCAAGGTTCCAGTCTTTACCCCTCGTTCAGGGGTCAAAATCCACGTGTCTG
ATCAGGAGCTGCAGAACAGCAATTCCTCTGTTGGTAAGATGGGGGAATGCTGAAGTTGAG
CTTTGTACCAGTTAACAAAAACCATGTGAATTTTAATAGCTGTTTCGGTCACAGATGACT
CCAGACTTGAGGAGCTGAAGACCCAGCTACCTTCCCCAGAGTCCTCCCAGTTTAAACTCT
GTGCCATTGAGTTTGAGAAGGTTCATAAACTTATAGAATCCTTTTTTTTGCCTACTTTGG
CTTCTCTTTTCACACAGTTCCCATTTATGTGACTGTCATTTGTTTTTAACAGGACGATGA
TACAAACTTCCACATGGACTTTATTGTAGCAGCATCTAACTTGAGAGCAGAAAACTATGA
CATTCCTCCTACAGACAGGCACAAGGTGGGACTAAAACCCCGTGGTTACTCCTCTCAAAT
CTGATTTCTTGCTTTACTCCTGCTCTTTTCCTAATGTTACCTTTTATCACCCAGAGCAAA
CTGATAGCTGGCAAGATCATTCCAGCCATCGCCACTACGACAGCTGCTGTAGTGGGCCTG
GTGTGTCTGGAGCTCTTCAAAATAGTCCAAGGACAGAAGAAGCTGGAGTCGTACAAGAAC
GGTTTCATGAACCTGGCCCTTCCTTTCTTTGCCTTCTCTGAACCAATTGCTGCTCCCAAA
CACAAGGTGGGCAGCTGCTGGTCTACCGCAGCGTGTGTACCTACTGGTTTGATGCCTTGG
TCAGAAGTGACATGTTTTCAGAGTAGAAATGGTTTGTTTATCTCCAGTGACGATGCAGCC
ATGCTAATACTGATGCACCAGACAGGCTTTGTCTGCCTGGGTGCATGTGAGTTCAGCTCA
GCTTCTCACGCTGACGTTTTCAGTGTGTGCTGAGGAGATATCTGTTGCCGTTAAATCATT
TTTAAAAAAACCTTTAAGTCAGTTGCTTAGAAATGATAGAACTGGGTTAATTGCTTTTTA
ATCTTTGTCACAGTACTATGAAATCGACTGGACGTTGTGGGATCGGTTTGAAGTCACGGG
GTTGCAGCCAAGTGGGGAGGAGATGACACTCCGACAGTTCCTGGACCACTTTAAAGTATG
TGTCAACACCTTCCCACAATGCGGCGTGACAGGTTTTGGATTCTTTTACCGTAAACCCCT
TTTTTAATTATTATTATGATTGCTTCAGAATGAACACAAGTTGGAGATCACCATGCTGTC
TCAGGGAGTCTCCATGCTTTATTCATTCTTCATGCCAGCTGCCAAGCTCAAGGAGAGGCT
CGATCTGCCGTGAGGATCATTAATATTCCTTTTTTTTTTTAAGCACCCTTCATTGTTCCT
GAAGTGTTTCTCTGCATGCTGACAGGATGACCGAGATTGTGACGAAGGTGTCCAAAAAGA
AGCTGGGCAAGCACGTGAAAGCACTGGTGTTCGAGCTCTGCTGTAACGACCTGTCAGACG
AGGATGTGGAAGTTCCCTACGTCAGATACACCATCCGCTGAGCCTCCGCAAGGAAACCTC
CCACTGGAGGAAGGGGGGAGCCGCCAGGGGTGGGAAGAGCGGGGTGGGCATTCTGCGTAA
GGAGGTGTGGGGTGGGTGAGTTGATCCAGGTCAGCTCTACTGGATTCTTTTAGGCCTGTG
TTTTTGTGTAAACCTGTGCCTGACTGTACATAGTCCCAGTAAGATGATATATGGATACTT
TGTGTGTTAGGGTTCCCAGTTGGTCCTGTGGGAACAGGGATGTGATGGCAGGAAAGGAGC
ATGTGTACTGGATTTCTGACTGACGTTAACGCTTGGTGTTTTCTAGCCACTCCGTGACAC
AGCTAGTCTCCCTCTGACTCATGCTTAGTCTTACTAAGCATTCAAAGTTTCCAAACGGTC
CTCCATCACTGTTTTTTTTTTTTTTTTTAATTTGCTCCTTTCCCTCATCAGACCCCTGTT
CTATGGACCCTTTTTCTTTTTTAAAGATGGACTTCAGTGATTTAAAAATGGTACAGCCAA
GAAAATACTCACGTGACAGTTTATAGTCAGACCTCCAAACTGAATCTGTAGAAGCACCTG
AAGACACCTTAAACCCGAGTCGACATCTTCTCCCGGCTGGAATAATCAGAATGGCAGCAC
TTAGTGTGATTTAGTGAATAAACGTGTAAAAACAAGTCTGATGGTGTCTGTGGTTATTTG
CTTTTGTGAATAACTTACTTATGCTCTTTGTTCTGTGTCTAACTTTCACAAGAATAAAAG
ATATTAAAGGCTGAATCGGCTCCTTGTGAGCAATGAGTGTGTTTTACTTTCCTGGGTCCT
GATAGATTGACTCGTTTGTTCTTCATAGTGCAGAAAGTCTGGCAAGTCTTGTAACTAAAG
TGTCAGTTAAAACCCTCCTCTCAGCGGATACATGAAAATGCAACTTTGAAAGGATGTGGT
CGAGTGTCAGATGAGGAAGAAAGTGAGGAGGAAGCGCTGCACCGAGGCTCCCTGCAAGCT
GCTCCTTTTTTGACGTTTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1117, 1197..1255, 1360..1528, 2070..2204, 2313..2419, 2508..2598, 2706..2838, 2913..3010, 3181..3327, 3729..3905, 3995..4102, 4178..4258, 4350..4502, 4797..4962, 5065..5261, 5442..5506, 5648..5843, 6154..6228, 6323..6512, 6594..6679, 6772..6864, 6954..7145, 7453..7554, 7648..7749, 7826..7960
1001..1117, 1197..1255, 1360..1528, 2070..2204, 2313..2419, 2508..2598, 2706..2838, 2913..3010, 3181..3327, 3729..3905, 3995..4102, 4178..4258, 4350..4502, 4797..4962, 5065..5261, 5442..5506, 5648..5843, 6154..6228, 6323..6512, 6594..6679, 6772..6864, 6954..7145, 7453..7554, 7648..7749, 7826..7960
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved