Tetraodon_nigroviridis Locus chd4b
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis chd4b
Tetraodon_nigroviridis
chd4b
8
SCARNA11
6210..6324
14804
CACCACAGTAAGTTTATAATCCCCGAAGGTAGGCATTTCATAGTTTAACTTTCTTTCTA
TAATTGTTAAACTCGCGCGTGCGAATTTGCCGCTTCTGTTTGAAACAATGATGGATGCCA
GACTTATCATAATTCAGTTGTGTCGGGAAAAAAAACTGCGAACCATGAAGGAGACCATGT
CAAGTCATTGATTATTTAGTTGTCTAAGTTATTTGCCCGCACCGATGGTAGCTTATTCGC
AACCTAGACAATAAACCCGGCAAGGATTAGCTACCAACCAATGCTATTTATTTATTTATT
TATTTTAGCACCATCCACCCCCTCCCTTCCTGGACACCCCCGGTCCATTCTCCAGCCCGG
TCCCACGTCATTTTCCCTCCTCCCTCGCCGACGGAGGAGCAAGGTTTAGGGGGGGATTAA
TTCGATCACGAAGAAACAGAATTGAAAATGTCGGGCAGTGAGGATGAGAGAGAAGACTTT
GGAGCCGCGGACGAGCACTCACTTCTTCCCGGTAAGATCGGTGTTTTTCATTTTTTGGCG
TGAAGAAGATTCATCTTTGAGTCACTTGAGCGGGCTAAAGCTAATGTTAGCTTTAGCCAG
CCATGAGTATTCGGCTCCGGCGCTCGCTGATAGATTAAGCTAGTTTGCTAACTTGTCAAG
CAAGTGTTGATAGCCGGGGTTACTTTTCGGCAGGAGCCTCGCTTTCGCCACACGTGGTTA
CCTCCATGCGAAGGAAACTCAAGTTTTGAGGATGGAACCGACAAGTTTTAACCTGTGCTG
TTGTGGCATTCGCGGCGGTTGCGTGTGCGCGCGTGCACGCGCGAGCGTGATCAGATCGTG
CCAGTGCGCGTTCTCTTGGTTTTCTCCCCCCTCCGTCCCTCCGGCCTGCGGCGTTCATCC
GGACCGCCGAAGCGCCGCGTTCTGCCCCGCGATTAAAGCGTGTTTCCCGCACAGGTGACG
ACGATCTGGATGATGCTTTATCTGACGTAGACGAGGTCCCCAAATCGAAGAAGAAGAAAA
AGGCGAAGAAAAGCAGCCGGGAAAGCAGAAGCAGTAAAAGGCAGAGACCCATCAGAGAGG
TCAGTTTTGTTTTGTTTTGTTTTTTTACCAAAAGAGCAAGGTAATGATATGTATGTACCA
GTAATTTGTTTGGTTATTTGCCGTCCTGGTAAACAATTCTGCGACCTTAATCGCATGGGG
TCCAAAATTTGCTAGCTGTTGGCTACCTGGTGGGCCAGTTAAAACTTTACCTGCGTTCAG
ACGGTCAATGGTAGTCTAGAAATTTGTTCAGGCTTTTCCTCACACTTCCAGGAGTCTTTA
TGCTGGCAAACAGCTTAAAATATAATGTGCTGCTGTTGTTTAAGTGAGAAATCTATTTTA
AAATCTATACTTACAATACTGGAAACATACAGATAACTGTCTCTGATGCAACAAACAAGC
ACCCGCACCAGGGGTTGTGTTACAGCTAACAGTATTTCTGTCTTTCAGGAGTTTCCAGTT
AGTTCCCCAGAGCATCTGATCGGTGCCGAAGCAGCAGATAGAGATCCAGATGATGGGGGT
ATGCGTTCTGAGAGTGAGGGAAGTGATTATGCACCTGGGAAGAAAAAGAAGAAACGCTCC
AGTTCTGCTAAAGATAAGAAGAAAGGTGCGGGTGCTGAGAAGGGAAGTTCATCTGCCTCA
AAGAGCAAACGCAAGGACCCAGAGCCCGACGACGATGACGACGACGAAGAGGATTGCCAG
GTAAACAGTAAATCTATCACAGCTGAGATGTGCAAGTAGATTTTCTGCTAACACCTGAAC
TCTCCATTCAGCCTAAAAGCTCAGCACAGCTTCTTGAAACATGGGGCATGAAGGACATTG
ATCATGTATTTACTCAGGAAGACTACAATTCCCTCACCAACTACAAGGCCTTCAGCCAGT
TTGTCAGGTAAGGAAAATGTTTTTGAGTGTGGTTATGGCTTTGGTCATCACAACTGATCT
TTCTGTTTTTTTCCCCCACATACCTAGGCCTTTAATTGCAGCTAAGAACCCTAAAATTGC
TGTATCTAAGATGATGACTTTGATGATGGCGAAATGGAGAGAATTCAGTACCAACAACCC
TCTTAAGGTATGAAGGTTAAACCCTGGTTGGAACCCAGTTTATCGGCGTAACGGCTTTGC
TGTTGAAAGTGTCTCAGTGTTGTCTACTATGTTGTAGGGATCCGCCACCGCTAATGCAGC
CCTGGCAGCTGCCAACGTGGCTGCAGCGGTGGAGAACATGGTGGTGACTGGGACAGATGG
AGGTGCAGAAACTGGTGTTACTGCTTCACCCGCACCGGGTGCCACTGCTGCTGCTGCTGC
GGCCGCTGCTGTCCCCCCAGCAGCCCCAGCACCTCCCGTCCGCAAGGCCAAGACCAAAGA
GGGCAAAGGTAAAGAATCATCAATGTGGTGCCTTCAGAATAGGCGATTTTGGTTGCTCAT
AATTTGTTCTAGATATTTAAAAATGTTCTCTCTCTGAATGTTAATTCTTCTGCGTTTTTA
GGTCCAAACGCTCGTAAGAAGTCAAAGCCCGCACCCAAGCCTCCGCCAAAATCCAAACCC
AAGAAGGTGGCACCGCTCAAGATCAAACTGGGGGGACTCAACAGCAAGCGGAAACGCTCC
TCTGTAAGATAGATTTCAACCTTTTTTGTTCTTTTCTATTTCAATGGGCATGGCATCTTA
GTTTGGCAATTATTTTTATAAAAAAATTGTCCTCCATATTTGCATTTCCGTTAGAGCGAT
GAGGATGAACCTGACGTCGACAGCGACTTTGATGACGGGAGTTTCTCCGTGTCCGATGGC
TCCAGCCGCAGCAGTCGTCCTAAGAAGAAACCCAAGAGTTCCAAGAAGAAAAAGAAAGGT
CTGGATAAAAGATACCTCATAAAAATGATAACTCGGGACAATAAAACGGTCTTTAGAAGA
TTTGATTTTTTTAATTGAGGCATGGTGAAGGCATGGCCAAGAAGCAAAGGTCTCAGTTTA
TTCTTTCGTTTTTTCCAGTGGAGACAGAGGATGGGGATGGATATGAAACAGATCATCAGG
ACTACTGTGAGGTGTGCCAGCAAGGAGGAGAGATCATTTTGTGTGACACCTGTCCAAGAG
CCTATCACATGGTCTGCCTGGATCCGGACATGGAAAAAGCACCCGAGGGCAAGTGGAGCT
GCCCACACTGTGTGAGTACCATCCAGTCCTTTTAAACTGCATGCAGAACAGGCAAATATT
GATCCTTTTACAAAAACAACAATGGCTTCTGATTGTTTGGGAACAAGGATCAGAACAGGT
TTAGAGAAAAGAAAGTTGGCAGTCTCCTGGAGGAACCAGAGCGGCAAAAATGGCTTGAAG
ATGAAAAATATGCAGCTGTTGCTAAACACACATAATCCAGGGTATTTCGTGAATATTCGC
ATCCATCTTTAGAACTTTATTCACTATGTTTTGCAAATGTCTATTCTTTTTCAAATTTAT
AGCGTATTTTTAGTGGGGTGTATGTAGTTTTGCAAAAGAGCCAGCTGAATGTGTTAAGTA
GCGTTTCATAGTCTGCTGTTTCCTGACAATATCTGATCTGCACCTTTTTATCGCTGGTGG
TTGATATAAAAACAGGATTTGGCATAACTCAGATGCCGCATGCATTTGAGTGGATGTTAA
ATTGGCTTTTGACCCTCTCCTTTAAAGGAGCTTATTGTTGATTCGTGGAAAGTCAAAACG
GAGGAAAAGTCACACCTGAACGTGAACTGATGTGAACTGGAAAGTTGCACCAATTTTAAA
TGTTGGTTGTTTAAAAATGAAAGAGAAAATTGCAAATTGCACTGTTTCCTTTGTCCCCAA
ACCATTTAGCTTATTTTCCATTTATCTTCTCCCCTTCCCCTCCACCAACCACTACCCCCC
CTCCCATCCCCCATTTCCTCATCTTGTCCCTCCCCCTGCCATTTCCTTGCTCCCTCCGCC
CCCCCCCCTCCACTGTGGCTCCACACAAATATGCATATATATGCTATGCGACCGCCTCCC
TCTCATGCCCACACGCACGCTCTGTGGCGCCGCCTCACACCCCTCCCATTTTCTTTTCAC
TCCATGTCACATAACCCCCCACCACCACCACAGCACGCGCGCGCGCGCACACACACACAC
ACGCACGCACCTACCTACATGGCGGCCGCTGCTGCTGCTGCTGCTGTTTCACTTTGTACT
TGTGCCACCAGGAGAAGGAGGGCATCCAGTGGGAGGCCAGGGATGATCTCTCCGATGGTG
AAGGGGAGGATGAGGAAGACAGGAGAGACGAAGGGGTGGAAGAGGAGGATGACCACCACA
TTGAATTCTGCCGGGTGTGCAAGGATGGAGGAGAGCTGTTGTGCTGTGACACCTGCCCCT
CCTCCTACCACATCCACTGCCTCAACCCTCCCCTCCCTGAAATCCCTAATGGAGAATGGA
TCTGCCCCCGCTGCAAGGTGAGTACAGTGTAGTGGTGCATAGGTAGGTGTGCACGCAGTC
TGTCTGGCACAATTACCTTTTGGTTTGTTTTTTTCAAGTAAAAACATGAGAAATTTAAAA
AATACAATTTTGATCAGCATTTAACGGCAAAGTGAACATTTTACATTTCTGCTTCCAAAC
AGTGTCCACCAATGAAGGGGAAAGTTCAGAAAGTTTTAACTTGGCGATGGGGGGACCCAC
CCGCCCCCACACCTGTCCCTCGGCCTGCTGACCTTCCCCCTGATGCTCCCGACCCCCCGC
CGCTGGCTGGGCGCAGGGAAAGGGAGTTCTTTGTCAAATGGTGCAATATGTCCTACTGGC
ATTGCTCGTGGGTGCTGGAGCTCCAGGTACGCTGCACACCCCCAGCGGCGTCCACCTACA
GGTGAACTTGTGTCCTCATAGACCTGCTCTTGACTGCTTGTCTTCAGTTGGAGCTGAATT
GCCAGGTGATGTTCCGCAACTACCAGCGGAAGACTGACATGGACGAGCCACCTCCTGTTG
ATTTCGGAGGGGAGGGAGACGATGACAAAAGCACCAAAAGGAAGAACAAGGACCCTCTTA
TTGCCCGCATGGAGGAGGAGATCTGCCGCTATGGTGTCAAGATGGAATGGCTGATGATCC
ATCGTGTCCTCAACCACAGGTAGGACAGTGAAGTACAAAAGGTGGATAATAAACACCGAA
AAACTATTAAAATTCTCCACACATACACTGCCGTCCACACTGCACGTCCTTTGTATCGAC
TGTGTCTCCATCGTGGTGTAACAACCTTGAATCATCATTGTTTTGATTGATGGATTGCCA
CCATCTGTAGGAATGTTTACACACGTTTTTCTTTGTATCACAATTGATGTTAGGTAAAGA
TTAAAAGGACAGTGAGACCATGATTTGTGAATTGAATAAATCGAAAATAATGTGGAAAAA
AAAATTGCTAAATGTATGTGCGAGTGGTTATGCTGTTGTTCCATCTGTCTTCTTTTTCAT
TACAGTGTTGACAAGAAAAACAATGTTCATTACTTAATCAAATGGCGAGATCTGCCTTAT
GACCAGTCAACCTGGGAGAGTGAAGACATGGACATCCCTGAATATGACCCCTACAAACAG
ACCTACTGGAATCACAGGTATTTTTCAACTCAATGCGATAGTGCGGAGTTGTAAATGTCA
CCGAACCTGTGTTTGCTCACTAAATGTAATTTTCTTCCAGAGAACTGATGGTAGGGGAGG
AGGGCAGGCCTGGAAAAAAGCTGAAGAAAACAGTTAAAGTCAAAAAAGCAGAGAGACCAC
CTGCTAACCCAGTTGTAGATGTAAGCACTGTTTGTTTCATTAAAAAAACAGCTTTCTGAC
TTACACTACTTAACTGTTGCAGACTAATCTTATCACGTGCAATTGTAAAAAAAAAGTCTA
AAATGCCTCTCAGGACTTAGTGAGAATTTATATATATATTTTTTTACTCTTCTTTTCTTC
CAGCCCACCATTAAGTTTGATCGCCAGCCTGACTACCTGGACAGCACAGGAGGCACTCTG
CATCCCTACCAGCTGGAAGGATTAAACTGGCTGAGGTTTTCTTGGGCTCAAGCCACAGAC
ACCATCCTTGCCGACGAGATGGGTTTAGGCAAGACTGTGCAGACTGCCGTCTTCCTTTAC
TCCCTTTACAAAGAGGTAAGAACCACGTGTGCTTCCTCTGTTCTGTTTGTGGAAGATGTG
GATTGAGTTAGCTGTCCAGTCTGCCCTCCTCTGTCGAACCATGTTAGCCGGTGGGGTTTC
AGACATGTGACAAAGAGTAAGTTTGCCCAATAAAGGGGATGAGTTCCAAGTTGGGAGCTC
CATCCTAAAGGCAGGGCAAAACATTATGCTTGTATGCGAGTCAGTCATCAGATAAACTTG
ACCACTCAGGCTAGCATGAATATGAAATTCCTTGGATAAAAGTACCGTTAAATGATGAGC
CCTATCCTGTGTGTGATCGTTATAGGGCCACTCCAAAGGCCCCTTCCTGGTCAGCGCCCC
CCTTTCGACCATCATTAACTGGGAGAGAGAGTTTGAGATGTGGGCCCCTGACATGTATGT
GGTGACCTACGTTGGGGACAAAGACAGCAGGGCTGTCATTCGCGAAAACGAGTTCTCCTT
TGAAGGGAATGCCATCCGGGGAGGGAAAAAAGCATCCAAGATGAAGGTAAGGAGAAAATT
CGAGATAAGCACCAAAAACATATAAAAAAAAGTGCTCTTGGTTTGTAAGCACCTGCTTTT
GTCTTTACTGTGCTTTGCAGAAAGACTCAACCGTCAAGTTTCATGTCCTGCTGACATCCT
ACGAACTGATTACCATTGACCAGGCTGTGCTCGGCTCCATTGAGTGGGCTTGTCTGGTGG
TAGATGAGGCGCACAGGCTGAAAAATAACCAGTCCAAGGTAATTAGAACAACAATCATGT
TAATTATTGGTTTCATTTTTTGTGCATCTTTGCAAACTTTGCATAAACTTTCATAATATT
ACAGCTGGTTTTCCACCATGTTATGCTAATTATGGCCTGTCTGTGATGGTCTATTTACTC
TGATCGTTCCTCTATTTGTTCAGTTTTTCAGAGTGTTGAACAACTATCAGTTGCAACACA
AGCTGCTGCTAACTGGCACACCTCTTCAGAATAACTTGGAAGAGCTCTTCCACTTGCTGA
ACTTCTTGACCCCAGAGAGATTCAAGTCAGTAGTCCTACATGAGAACACACCATTTACGT
GACCATGTTGCAGATACTCTAGAAAACACCTAGACTCTGCTATCATTTAAACATCGGTTA
CACTCATTATCTCCGCAGCAACCTGGAAGGATTTCTTGAGGAATTTGCAGACATTGCCAA
AGAGGGCCAGATCAAGAAGCTCCATGACATGCTGGGACCACACATGCTCAGGAGGCTGAA
GGCCGATGTGTTCAAGCTACATGCCATCCAAGAGTGAGCTCATCGTTAGAGTGGAGCTTA
GCCCCATGCAGAAGTAAGTTGGCAGACCGTTCTGACTAAATACTCAGACAGTGATTCTCT
CTGATCTGATGACTGTTTTTAAAGTGAATTCGTTTGACTGAATGAATGTGTTTTCTTATC
CAGGAAATACTACAAGTTCATTCTTACACGCAATTTTGAGGCCCTGAACACCCGCGGAGG
TGGAAACCAAGTTTCTCTGCTTAATGTGGTGATGGACCTTAAAAAATGTTGCAATCACCC
CTACCTCTTTCCTGCGGCTGCCACGGTACGCTTCAAGTATTGTTCATGTGATTGCGGATT
AGTTAGAAAGCGAAACCTGTTTAATGCGCTTACTTTATTCGCTCTTCTTCTTTGTATTCA
GGAGGCACCAAAACTTCCCAATGGCATGTATGAGGGAAATTCCTTGGTGAAATCTTCAGG
GAAACTGATGCTGCTCCAGAAGATGATGAGAAAGCTGAAGGAGGGGGGCCACAGGGTTCT
TGTTTTCTCTCAGATGACAAAAATGCTGGACCTGCTGGAGGACTTCCTCGAGAATGAGGG
TTACAAATATGAAAGAATTGACGGCGGGGTCACTGGAAACATGAGACAGGAGGCTATCGA
CCGCTTTAACGGTGAGTTTAAAGCAGTTGTTTGTCTTGATTTTAAAACCCAACTACAGCG
GTCCAACAACGTCCTAACCTTTTGTCTGCTTTCGTCGTCGTTCACAGCTCCAGGGGCTCC
TCAGTTTGCTTTCCTCCTCTCTACCAGAGCAGGTGGTTTGGGCATCAATCTTGCATCTGC
TGACACCGTCATCATTTACGATTCCGACTGGAACCCCCACAACGACATCCAGGTATGCAG
CGCAACAGCTCGCATCTGTGTTTTCGTCTCTGACAGGATCAAAGAAGACAATGCGGTTTG
TTTTGTCGGTGCTTTGCAGGCATTCAGCCGAGCCCATCGTATCGGCCAGAACAGGAAAGT
GATGATCTATCGCTTTGTTACCAAAGCGTCTGTTGAGGAGAGAATTACACAGGTTTGTGA
AATAGAACACCAGAATGTTTTACACATACTTGTTGTCTCTGATTAGTGAATATCTACCAG
AAGCTTTTTTTAAAAAATATATTTGCTCTGTCAAAAGGTGGCGAAGAAGAAGATGATGCT
GACCCATTTGGTGGTGCGACCTGGTCTTGGCTCCAAAACGGGCTCCATGTCCAAGCAGGA
GCTCGATGATATCCTCAAGTTTGGAACAGAGGAGTTGTTCAAGGATGAAGTTGGCGATGG
TGTGTGCTTAAAACCTAACCCTGCATATATCTTTTTTAAATTAGTTTTTAGTCATGGCAT
TAGTAACCCTCGCGTTGTGGAAAGTAGCTGATCCATCAGACTTTTAACATGGCTGTCGAT
GTAACTACTTGATTGTTCTTTGCTGTTAACCTAGTTTAAACTGACCTTTGATTATTTACC
ACCAGTAAATTTTAACACCCGGGGATGAAGTAATTTAAATAACCGTATAAAATTCTGCAG
TTTAGGCACCATTGTAGAGGGGATCACTGTACCGTTGGGATGGTCTGATTACTAATTTCT
GCTTCCTCCGTTTTGTTTGCTTTTAGGGGATAACAAAGAAGATGACAGCAGTGTGATCCA
TTATGACGATCACGCAATCGACCGCTTGCTTGACAGAAACCAGGACGCCACTGACGACAC
CGAGCTCCAGAGCATGAATGAATACCTCAGCTCGTTCAAGGTGGCCCAGTACGTGGTCAA
AGATGAAGATGATGAGGTATGAACATGTCTGTGAGTGTATTCGTGTGAATACTGCAGAGC
GTATTTGTATGAAATAACTCTTGCATTAAAGTGTTTCAAGCATTTAAGGGTTAGGCAGTT
TTTAGCGATTGGTAGGCCTGTGTTTAAATGCTCTTATCTTTTTTTAATGGAGGAGGAAGA
GGTGGAAAGGGAGGTGATCAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAGCT
GCTTCGCCACCACTACGAGCAACAGCAGGAGGATCTTGCTCGAAATCTGGGCAAAGGCAA
AAGAACCCGAAAGCCGGTCAACTACAATGATGGCTCCCAAGAGGAACGAGGTATAAGACA
GGGTACAGAACTGCATTCAGTCTTCAGTATAATACTGTTTGTTGTATTGTGTTTGTGTGC
TGTGCTGTGTTGGTGGACTTGCATTTTGTTGTTGGTGGTGAAAAATGTAGAATCATCAAC
GTGCAATTTACTGGTATGAATCAAAATTGATAATATAATGTCACAAACAAACTTGGTAAA
TATGCTCACTTAAAGTACATCTTTGAATAGACAAACTTGGTTAAATTCAATTTAACATGT
TGCACTTCACCTCTAAGTGGTGCTGTTGCTGAATTTATGTCTATTTATTACATAGTTTCT
ATAATAATTCAATTTCATTTCTGCTTTGTTAGAGGAGGAAATGCTAAAAAAGCAGAATAG
GAGGCTGTGGTTGCAGACAATGGTGTTATTTAATATGCTGACACCACTCAAAGTACATTG
ATAACACTGCTGTTACTGTTGTCGTCAGAACAGGATAAAAAGTAAATTACACTTATTTTA
AAGCAGTTTGAAACCAACAAAGTAAATAAATGCTGCAGTGACACCAACATCAGAAAATGA
ATGGAAGTGTGAGAGAGTACTAGAACGTTGCATGTTTCACTTGTTTTTCATTGTGTTTTC
TTTCATACAATTAACAGAATTCCTGCCTCATGCAAGCGTGTAAAGGTAGACTAGGTGTTT
TTGCATGTTTTGTTACTGTAATAGAGTCAAATGATACAAAAACGTTGATTTTTTTATAAT
TTGATCAAAATGTAGCTCTGCGTCAGTAGCTCCCCCGTGTGGTCATAAGTCAGGTTACAT
TTATTTATGGAAACTACTAATTTTTTTAGTCGTATTTCAAAAAAAAAAATAGATTTTGCT
GTGATTTAGACGGTGCTAACTTTTAATGTGTGTTTTCTTTAGACTGGCAAGAAGATCAAT
CTGATAACCAGTCCGACTACTCTGTGGCCTCTGAGGAAGGTGACGAGGACTTTGACGAAC
GAAGTGAAGGTAACGCTCAGGCCAGTCGTAACTGTTGTGTTGGGAACGTATGTGTCAGTG
TCACACGATCAAAGAGCCTCTTTTTTAAAGGTTTGTTGTCATAATTGACTGTCCCAACAA
TGTCTTGATCTCAATCTCTCTTCTAAATACTTAGCTGGTACTTTCACAGTATTCTTAAAA
CCCCTCCTGCCCTGTTCAGACACAAATGACAGTTTTAACAACTGTTATAACACCTTGCAA
AGCTGCTCTTGACACTGAATTTTCTGTACTTTAGAGAGGTAACAGTTTATAGGAAAAATA
GGGAAGAATGTAGACGTCTTAGGTTATTATGGAATGACTGTGTGGATAAGGCAAATTTTC
CCAAGGACATCTATCTTATTTTATTTCATTTCCAGCTAATTCGCGCAGACCCAACCGTAA
AGGGTTGCGGAATGATCGGGACAAACCTCTACCTCCGCTGTTGGCCAGAGTGGGCGGAAA
CATCGAGGTGAGTTCCTACAAATAAAGACGAATGCTTTAGAAATGCTCTGAAACGTATGA
AAAACTACTACATCTGCTTCATCCTGTATTCGGTAGTTCTTGGAAGCACAAACGTGTGAC
CTCATTTTCCCAACCAACAGGTTTTGGGCTTCAATGCACGACAGAGGAAGGCTTTCCTGA
ATGCCGTCATGCGTTATGGGATGCCGCCCCAGGATGCTTTCACTAACCAGTGGCTGGTGA
GGGACCTTCGAGGGAAGTCTGAGAAAGAGTTTAAGTGAGTTACAATGTATTTTTTTTTTC
CTGCATTTTTGTGTTTCGGTTTAACACCAGAGAAAGAAACTGACTCAGTTGTCTCAAATA
GTTTCTCAATATCTATGTTATTTGGTTTAATGTTTTAAGTAGAGCATGCCCAGTGTATTT
CGAATGTTTCTTTGCTCACAGTCTGTTACCTTGTTCTTGTTCCCAGGGCCTATGTGTCTC
TCTTTATGCGTCACCTGTGTGAGCCTGGGGCTGATGGAGCCGAGACCTTTGCCGACGGAG
TCCCTCGTGAGGGCCTGTCTAGGCAGCATGTGCTCACCCGTATCGGTGTCATGTCACTAA
TAAGAAAAAAGGTAAATGCGAGCAGCCAGAAATAAAAGTGTGCAGAGCGCGGGGACAGTA
TCGGTATTTAATGTCTGTGTTTCGGGTTGCAGGTGCAGGAGTTCGAGCATGTCAACGGCC
AGTGGTCCATGCCCTGGATGGCCGAGCTGGAGGAGAACAAAAGGGCTGCAGCTCTGGCTG
CAGGTGAAGACCCAAAGACTCCCTCAACAGGAACTCCTGCCGATACACAGCCAAACACCC
CTATCCCAGGTAAACACACACCCTCAAATGGCGCGCTCGACTACTGACCTGTATCACTAT
AACAGATAAATAATACTGACACTATACTTGTGCTGTAACTCTGGTATGTGTTGATTATTT
TGTCAGAAGATTTGTCTAAATCGGATGAAAAAGACGACACAAAGAAGGAGTATGAAGATG
GCAAAGCTAAAAAAACAGATGATTCAGAGGTGATTTAAACGCCTTTATTTTAACAAGTGT
CGGGGACTTTAGTCGATTTGGAAAGTGACAACTGTTTCTTGTTTCAAGATTATCGAAATC
CCAGATGAGTCTGAAAAGTCACCTGACTTTGAAAAGAAAGACGTAGACGCCACAGCAGAA
AAAGAGGAAAAGAATACAGGAAATGGAGATGCAGGAAAGGAGAAGGAGGCTGAAGATGCC
TGCAAAGAGAAAGAGGAAAAGGACAGAACCTCGGAGTCAGACAAAGACACTGCTGAGGTC
AAGGCTGAAGGCTCGGAGGGAAAGAACAGTGAAGCAGAAGTGGGGAAAGACGAGAAGATG
GACACCAGTTCACCTACAGAGGAAAAGAAAGGTTACTCCACCATGTAAAACTAAGCGTTG
GTTTCGATATGCGAAACTACTTTTTTAACGACTAATGGAAACTCTTTTTGCTGCCATTGG
TTTTTCTAATTCAGAACTGAAGGAAGAAAAAGATGGTGTGAAAACAGAAGAGGCTACCAA
ACTGCAGAATGGAGAGAACACCAAAGAAGGTGCGACAGCTGCATCGGTGGTTAACGTCAG
CGAGGAGAAGAAGAAAGCAACCAAGCAGAGGTTCATGTTCAACATTGCAGATGGAGGATT
CACAGGTGGGGGGAGGCGTGAGCACTTTTTTTTTGTTTGTTTTTTTTGCACTGTCTTGAC
CTTTTTTCCCTTTATTTTCAGAGCTGCACTCTCTGTGGCAGAACGAGGAGAGAGCAGCCA
CCGTCACAAAGAAAACATTTGAGATTTGGCACCGTCGCCATGACTACTGGCTGCTGGCTG
GCATTATACAGTATCCTTTAATGGAAAAAGGTCATTGGAAAAGAGAGTTTTGATCTGAAA
CTCTCAATCAGCACAGGACTTTTTTTTTTAATTTAACTGGATGTCTTATTCTGTCTTCAC
ACCCAACTTTCTGTCCCCGAGGCCCTACGCTGTGTTCTGTTGTCAGGCAAAAGTAAAGGT
GTTGCAGAGTTTTTGCAGAACTCCAGAACACTGTAGATGCGGTGGAGTCATGGTGCAGCA
GGGCTGGTGTAAGCACGCGCATCGTATTAGGCATTGACGACCTTGACTCTGGCGTCTCCC
AGACATGGCTACGCTCGATGGCAGGATGTGCAGAACGACGTGAGGTTTGCCATCCTCAAC
GAGCCCTTCAAAGGAGAGATGAGCAGAGGGAACTTCCTGGAGATCAAGAACAAGTTTCTG
GCGCGCAGGTTCAAGGTAGCTTGAGCTCGCGGCTGTTGTCGCTCCTTGTGTGTCTTTCTG
GTTTTTTCCCTGTCTTTTACACGTCATGGGTGTTGTCTGCGTAGTTGCTAGAGCAGGCGT
TGGTGATCGAGGAGCAGCTGCGCAGGGCAGCGTATTTGAACATGACCGAGGATCCGGCTC
ACCCCTCCATGGCCCTCAACACTCGCTTCAGCGAGGTGGAGTGTCTGGCGGAGTCCCACC
AGCACCTGAGCAAGGAGTCCATGTCTGGGAACAAGCCTGCCAACGCAGTTCTACACAAAG
GTAAACTCAGGCTGCAGGTAGAGCCGACTGATGGATTCTTAAATGTCAGGAGCCCCTCGG
GGGAACTCAAGCCTCGTTTATTTTTGGCATGTCCAGTCCTCAAACAGCTGGAGGAGCTTC
TGAGCGACATGAAGGCCGACGTCACGCGTCTCCCGGCAACCATCGCCAGGATACCCCCTG
TGGCCGTGCGGCTTCAGATGTCCGAGAGGAACATCCTCAGCCGGTTAGCCAGCCGGGGCC
CCGAGGTCACCAGTCAGAACCAGTCGCAGACCTCCCAGCAGATGCAAGTGCCGCGCTGAC
CAGCGACCTCGCTCGTCTCACTCCCACCGACCGGGGCCAGTCACAGTCACCTCACCGCCA
CGTAGCAGACGTCCTCATCCGTGTACAGTCACACTAGTCCTCGTCGTCCACCTACCACCC
ACCCTCAGGCTCAGAATGCTGCTGCAGGATTGGAAAAGGCTGGAACTGTAGAGTCGGGAT
GGGAGCGAAAGATGCTTTTTCTCCTTAAAAGAGATCCATATTGAACCGTTGCAGCTAAAG
CTGAACCGCAGGGACCCTCCACTGACTCTTTCTGTTCCGTCAGGTCAAACTCACGCGTGT
ATCGCAAAAGTGCGGAAGCCAGACGGGAGATTTAAAGGCATGCCTGGAGTATGCAGGTGC
GTTTCAGTCATTTGGGGCCGGTCGAATACAAAAGATTAGTGTGCTCATTTCACTCTCGGA
AAAATGTAGAGTTGCTGTCATTGACTTCTCCCGTCTCCTGTCTGTGTAGAGCGAGTACGT
GCGTGAGTGTTTTGTCTTTGTAAATTAGGGCATATTAATGTGCACCTCTACTGCAGAAAA
GCCCCTGACGCTGACTCTTTAAGATCACTTTTTCTACCAGTCGGTCAGGTTCGTTACCTC
CTCCCGCATCTTCATCCTCCATCCCAGTGCTCCGCCTTTTCTCAGTTAGGTGACCCGGTC
CAGGATCAGCGTCCTCAGAACCTTGACATTCCCAACAGCACCTCGGAAAAAAAAAAGATA
TATCCTTTGTCTACCTGGACGCGATCCTTTCACAGCTCTTAGGTACATGGGATGGTTTTG
AGATCAATGGCAATCTTAATTTAATTTGTTACTGTTAAATTGTTTTGCATTGTTGAATAT
TAATATGGGTACCACCTTGATTTTATCATTGCAGTTTGTTTTTATGAACTAAAATAAAAA
GTCAACAGTTTTTCAAAGTCCTGGCAGGTTTTTTTTTTTTTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1078, 1509..1661, 1811..1926, 2007..2106, 2197..2316, 2353..2407, 2521..2642, 2754..2883, 3009..3190, 4211..4456, 4622..4825, 4907..5118, 5465..5596, 5680..5779, 5943..6134, 6445..6645, 6740..6877, 7043..7164, 7278..7452, 7563..7704, 7801..8050, 8147..8271, 8359..8451, 8557..8698, 9026..9195, 9352..9529, 10422..10502, 10895..10986, 11120..11253, 11446..11590, 11672..11828, 12053..12079, 12145..12403, 12600..12664, 12741..12849, 13142..13274, 13364..13559, 13650..13804
1001..1078, 1509..1661, 1811..1926, 2007..2106, 2197..2316, 2353..2407, 2521..2642, 2754..2883, 3009..3190, 4211..4456, 4622..4825, 4907..5118, 5465..5596, 5680..5779, 5943..6134, 6445..6645, 6740..6877, 7043..7164, 7278..7452, 7563..7704, 7801..8050, 8147..8271, 8359..8451, 8557..8698, 9026..9195, 9352..9529, 10422..10502, 10895..10986, 11120..11253, 11446..11590, 11672..11828, 12053..12079, 12145..12403, 12600..12664, 12741..12849, 13142..13274, 13364..13559, 13650..13804
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved