Tetraodon_nigroviridis Locus Mono:SNORA13
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORA13
Tetraodon_nigroviridis
Mono:SNORA13
8
SNORA13
1001..1132
2132
CTTTTGTTTAGTCATATGTTTTGATCGACCGTAATTTTTTCCACTTGTACACGTACGTA
CATTCATACAAATAAACGTTTAAATACAAGCGTGTATAACACACATACGTTTACATATAA
AAGTACATACATATAGATAAAATTAATAAATAAGAAGACGTGTTTTTTTTTTAAATTCGC
TTCTCAGATCAGAGTAGAGCTTCCGGCTTGACTGCCTCCTGTCACGTGATTTTCCGGAGA
CGGTCGAGAGACACGCGCAGACATGCCTGTGAGTACTGATCTGTCCGAAAGGTTCTTTAA
AGTGTATTTTTGATTGTATTAGCGAACGCGATTGAAATAATCAAGTCTTCTGCTTTGCAA
ACAAACTGCTTTGTTACTGTAATATAAACGCAAATACGATTAAAGGTAGCCAATATGGCG
AACACGTGCTCGGTGGCACAGCGTAGACATGTTGGGACATGTCTGCCAGAAATCCCAACT
CGATTAGATTGATTATTGTTCCACATTTACACAATTTCTTTCACTTGAAAAACACCAAGT
CATCGAAAACACAATAACCTTTGCCTCTTAATAACGTCGTAAAGGTGGTTTATTGTGTAA
CGATTAACGACGGAACAACAGTAAAGCATGGTCGCTGATTCGGAATCTCCTATTTCATAT
ATTTATTTTTCTTTTGCTCAGCTTGCAAAGGATTTGTTGAACCCCAGCCCCGAGGAGGAA
AGGAGGAGACACAAGAAGAAACGGCTTGTGCAGTGTCCAAACTCCTATTTCATGGACGTC
AAATGCCCAGGTAACCCTATTTGTTTACGCGTCAAAAGGCTATCCTTAATTTAAATTTGG
CACTGTTACGAGGAAAAAAAAGACCTTTTAAGATATTACCATCAGATTGAACTGATTGTT
TATTTTTTTAATAAAAAAACCCATCCATTTTATTTATACTGACACAGCTGTGACTGATGT
ACTGGCCCCAGATCTGTAGATCACTACTTTGCTGGGTTATTTGCCTTTATGTGTTGCTCT
GTCATTGTTGACGTAATGACCAGGGTGTCAAGCGAGGCATACAGAAACACATGTGGCTGC
CTGTGGAAAGAGTTTCAGTTAACTCCCTAAAGCAGCCAGCTGCACGAACACACTGTGCTG
GCGGTGAAGATCACATGTGACGTTCATTGTTATGGTGTTGTTCAACCTTTCACGGCTTGT
GTGTGTTGTTTGTGTGTGTGTGCAGGCTGCTACAAGATCACCACAGTGTTCAGTCACGCT
CAAACGGTCGTGTTGTGTGTTGGCTGTTCCACAGTCCTCTGCCAGCCTACAGGAGGGAAG
GCTCGTCTCACAGAAGGTACGCAGAGTGCACGCCTCATCGTGGAACCGATTTTATTGCAG
CCAGCTGCAAGGACAGTTTGTTTAAAGTTAAGCAGGCACAGCGAGAAATGGTTTCAGATC
TGCCCATTTAACCTTTCAGAAAAAGGTGGTTCAGCCTGGCTTGTGAGCTGATTTTAGGCC
TGATTTTTCCTTGCGTTGGTACATCAGCTCAAGGTCTGTGTTTAGCGATGCTTTTCTCCA
CCCACCTACAGCATCCTGCTGCTGTGGTAACCAAGGACTCTGGAGTGCGTGCTCATCTTT
GAGCTACTCTGGGTGCAGCTGCATGTGTCGGCTTAAAAGCCTCACTTGTTTAGAGGAGGG
ATGGGTTCAGAGAAGCATAAAACAATACTATTCCGCTCATTCGTAAAGGTGAGCAGAACC
TGTAGGTTTATTGTGCACTTTGAAATGCACCCAATAACCTGCCTGAAGCTGCAGCTGTTT
TCATGAGCCAGCGCTGAAAACAGACAATATTAAGTGATGAAGAGTTTTAAAGCGTGTTGG
ACCAGTCCTGACTTGAACCCAACAGCAGATGCTTAAAACACATGACAGTACTCTTGTTGG
CATATGTGATAACTAACAACGGTCTGTTGGATGCATCTGACAGGATGTTCATTCCGGAGG
AAACAACACTAATCTGAACAGGTTCGTCTGGGCTTGGCTGAACTGTCGACTAGACCTGGA
GTCACACTGCCACCGAGCTGGTGCCACAACCAAGACATGGAGCAGGAAAACCAATATGTC
CCATAAAAAAACCCCAAAGTGCTTAATCCCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved