Tetraodon_nigroviridis Locus atad2
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis atad2
Tetraodon_nigroviridis
atad2
8
SNORA5
5671..5799
10286
GACCTGACATCCCCATATACACTTTACCGTATGTAAGCGGCTAGCGTGCTAAGCTACTT
AGCTTGTCAGTTTAACTGCTATTAAGTTACTGTAATAGGCACTACATTATATATATATAA
AATGTATATAACAATAAATGTTCCTGTGCAGAAAGAGCATCAACGCCTCTCTGTGTGTCT
GGATATTTGTGACTTGAAATAGATTAAAACTTGATATAGGTCTGGATCAAAAACTTGAGC
TGTTAAACGGTAATGTATCCTTGAGAGAAAAAGGTTACATAAGCAAAACAACTCACTCAT
TTGAACTTACTGCACATTTGCCGGTAACCACAGGATTAAATCCAGTTATTAAAACAAACT
TTGACAACTGCTTTTTTTAGATCCATGTCCAGTACTATACGTGTGTGTGTGTGTGTGTGT
TTAATGACCTTCCAGGTACATGCTGGTATAAATCAATCTATGAGGACCCGCAGACAGAGA
GGTGCACCGGAGACCTCCTTTACAGACATGGAGGTGAAGACCAGCTCCCCAGTTACTCGA
GACAAAGCTGGAGGATGCTGCACCAGGTTAGACGTGGAGACATTCCTGAAATATAATTTG
ATGTCCAGACAAATTCTCTTGAATCTTAAAGACATCCAGCCTTCCTTGTCTTGCAGGGTG
ATTCAAGGAAAATATTTTGTAATAATTGTAACTTCTGTCTAATACGTGCACGAAGAATTC
GTACACACCGTTATGCACTTTTGTTTACAAACAAAATCATCATTGAGTTCATACGTCTCG
TTTCAGGAAGTCTTCTCGGCTGCAAAAAGAGGAAAAAGCATCTAGTGGCAAACGGCAAGC
AGGTAAAAGTACCTATAATGTCAGTTTTTTACAGTAACAGCTGGCAAACACTGAAATATT
ATAAAAAGCATTGACTCAATTTTGCCGACATTCTAGATGTTCCTGATGAAGTGGAAGGGT
CATCAACTCCCAGGCGGAGTCGTTTTGATTTGCGGAGCAGACATGAGGCAGAGGAGGAGT
GCTCTGTGCGCCGAAGCTCCAGAATCACAAGATGCAAACTGAAATCCCGCAATCAATCGG
TGCTCTATGACTGCCTGATTACCAAGTATGTCCACCCACAGTCCAGGCTCTTGTCCAAAC
CTCAATGTTTCTGCAGCAAAAAATAGTTTCAGTTGAAATCTTAAAAACTTTTTATTAATA
ATAATAATAATAATAATAATAATGATAATCATAATGGTTGCATAGGGACATTACATTGTT
TTATACATTTTCATGGTAACAATTTAAATATAGATTAAACTGTAGTCCTTGAGGTTCCTG
CCCACTAAATTTATTAATATAAAGTTGACTGATAAAGGTTGGTGAAATAAATTCCTCCTC
TGATTGTCCGTAAGCACGGCCGAAGCTGTTCTCCAGAAGATGGATGTCATGAAAAAGATG
CGGCGCAGGCTGAGAGACAGAGACGACCCAGAAGAGGTATTACTAGAAAGGACAACTGCA
CTACATCATTGGTGTACTTTTTGTTTCATATGTGCAGTGGAGACCCTTTGATCCCACGTA
ACCTGTTTTAAAACTTCAACCGCATTCACATGTGTCCCTCCCAGCAGCTGGGCGTATACA
CCAGGGGGAAGATGAGAAACCTGATGAGGACGACCATGGACAACAAGGGCATTGTGGAGG
AGGACCAAGGTGAGACGAGAACACAGCTCTCCGTAGGAGAACATGGCAACCAAATGAGGT
TATTTTATATTTTTTCCAAAATTTAGGAGAGAATAAAGATGGTGATGATGATGATGACGA
TAACGACGATGATGAAGAAGATTATGGGGAGGAGGAAGAAGAAGATGATGACGACGACGA
CGAAGATGACGATGACGACGACGACGTGGACAATGTTAGGGATGATGATGAAGACGAGGA
AGAAGAAAATCAGAGAAGATATGACTTTAGACAAAGAAAGGCTGTGGTTCGCTACCAGGC
TCCACAGGACGGTAACTCATCCTGTTTAGTCTGCTCCATTTGCCTGTTAGGGTATAAAAA
TCACATGTAAGCATGTATAGAAACCTTGGTGAACTTACCACAGGGCCCCAATGTGGGCTG
TTAATGTGGAGGTTCACTAAAGTAATTAACAAAGATATTTCAGTAAGCAGGAGCATGTTT
CTGTGTGATAAACGATAGTTAAGGATTCTCTTGCTGGTTATTTTTTAGAACCCAGAGAAC
CCAGAAAACGCACCCTGTACTTCAAGAATCACTCATCTCCAACCAGACGTAGATACACAT
TCGGCTCCACGGCCCCCAGGAGCCCCTACAGCAGGAAAAGCAGCAGGTGAGTAAGATAAA
AGAGTCGGCTGCATCACCTCATCTGAAATTGTATTTGCTCTTTAGAGTATATTGTTATTA
TCCCTCAATGGGGAAATTTCAGGAATATTTCTCCTCAACATTTCTCCCTGAATGTCCTTT
GTAATTTTATTAAATATGAAGTGGTTCAACCAGAAGGAAGCGGCCTCATTCTCGAAATTT
GCACTATTTTTTTCTGTCTAATCTTCTTGCTTCCGCTAACGGGAGCAGTTCTGAGAGGAA
AGATCCTACCTGCTCTCACTGCTAATGTCAGTCTACAGTTTTAGACTCTCTGAGTTTGGT
GGTGGCCACAATTTGGTTGAACAAGCTACATGTTTTACCAGTGAAATAAAGCTCCTTCTG
ATGATATATAGCATGGTTAAATTAGTCACTTTAATCATATATATAGCTATTAATATGCCA
TCTTTTTAAAATGATTTAGCAACCATGTTGTCCTCTGATGTTTTCCTTCTGTTGACTAAC
ATTGGGGGTTTTTTGTTACGAGCCTACATCTCTGTGAGTGATATAACCTGGCTGCATGCT
TGTGTTGCAGGAGGAGACACGCCATTCACAACAGTGATTCCACTTCCTCATCTTCAGACG
ATGAGCAGTTCCAGAGAAGGAGAAGCAAGAACAGGAGCAGGTCAGTCAACAGGTGAGAAG
GTCCGCCTGGGAGGCCTGCACACATACCTGCCTGCAGCACAAAACAGCAACATAATAAAA
GAGGAACGGCCAGTTTAGAGTATTTTTCTCGTAGATTTTTACCCTTGAACTTTAAGAAGG
ACGACATCCTGGGGATCCAAAAGGACAGGATGAAGATCGGAGCAAGCCTTGCGGATGTGG
ATCCCATGCACATTGACAAAACGGTGATTACTCCAGTATTCTTGCCAACGATTGTCTCAA
TTTAAATGTCACTGGTTCCAAAATTACGTCGATATGGCGTAACAGAGCGCAGGTTTGTTT
GGTTTTATATTTGCGGTTTTTGAACGGAGACTAATTGTAAAATGATATTTGACATTCAGG
TGCGCTTCGAAAGCATTGGAGGTCTGAGTAAACACATTTCAGCGCTGAAGGAGATGGTGG
TCTTTCCTCTGGTCTACCCGGAAGTCTTTGAGAAGTTCAAGATACAGCCTCCGAGGTAAA
CTCCCCATCTGTTCTTTTAGTAATTCTTATTTTTTATTATGACAAGCAGAGCATTTTAGA
CACAGATGAGGGCAGCAAAATTTTGTGTCTCACATTAGATCCATGCTAATAACTTCGAAA
TGCAGAAAAAAAGATAAGAAGTTTCAATGCAACAAATATAAATTGCTCTCTGTCCATTTT
TCTCTGTTCATCTGTCCCCAGGGGCTGTCTGTTTTATGGCCCCCCAGGCACAGGGAAAAC
ACTGGTAGCCAGAGCTTTGGCTAATGAGTGCAGTCAAGGGGAGAGAAAAGTCTCTTTCTT
CATGAGAAAAGGTGCTGACTGTTTGAGTAAATGGGTGGGAGAGTCGGAGAGACAGCTACG
GCTGCTTTTTGATCAGGTAATTACATTTTCATACTGATCTCGGTGAAACAACTCTGCTTT
ATCTACCTAACCATGGCGTAATAAAACAGCATGTCTCAGGGGTATAGAAGTGTGTTTTTT
TTTTAAAATAAATAGTCTATTCGATTGTTTTACAGGCATACCAGATGCGCCCGTCCATCA
TCTTCTTTGACGAGATTGATGGTTTGGCTCCAGTCAGGTCCAGTCGTCAGGATCAGATAC
ACAGGTAAGCAGCACCGACGCCACAACTTTGTAGATCTGAAACTAGACTTGTGTGGAAAA
ACACACTTTTCTGCCTCCAAAGTTCCATCGTGTCCACCCTGCTGGCGCTCATGGACGGAC
TGGACTCCAGAGGGGAGGTCATTGTCATAGGAGCTACAAACCGACTGGACTCCATCGATC
CGGCGCTGAGAAGACCAGGGCGCTTTGACAGGGAGTTCCTCTTCGGCCTGCCAGACAGAT
GGGGTAAAAAGATGTAGAAGCCTTTTGCTTGCCAAAGCGACTCGGTGCTTTTTAGGCTTG
TTTGTTGATCATCTTTTGTATGGCAGGCGAGAAAGGACATTCTGAAGATCCACACCAGAC
TTTGGACCCCACCGCTCTCGGACCCCTTTTTGGAGGAGCTGGCGGATAAATGCGTCGGTG
CGTTTGTGTCTCAATAACTACTTTAGATTGAAACGAAGACGCTTGAGAAAAAAACCCTGG
CAGCAACCCTTTCTTTTTTCTTGTCTGTGCTTCCCAGGTTATTGTGGCGCTGACTTGAAG
GCTGTGTGCTCAGAGGCCGCCCTGTGCGCTCTGAGACGGCGGTACCCGCAGATCTACCAT
TCCTCGCAGAAACTCGTCCTCGATATCAACTCGATTGCCATCACAAACAAAGACTTTGTC
TGCGCAATGTCCAAAATAGTGCCTGCTTCCCAGAGGTATAACCAGAACGGGTGGATGTTG
CATTGTAAGCATTAGTTGGGCCCTGGGTTTGTTCTGAATGTGAGTGTGTGATTGGTAGAG
CGGTGGTGTCACCAGCCAAGGCCCTGGTTCCTGTCGTTCGTCCGCTGCTGCAGGCTACCC
TGCAGGACATCCTTCACATCCTCGGGAAGGTCTTCCCACATGCTGAACAGAGCTTCCAAA
AGCAAAGACAGAAAGGTTCGGTCCTGCCTGTCGGCTCTAAAGGCGTGCAAGTGCCCATAG
ACCCTAGAGTAACCGTGCGCCATTGTATTCATTTTCAGACGCGGCCTGTGACGTTCTCGA
GGACGATCTCCTTTTGAGTGCAGAAGAGGAGGCTGGAGACTGCAGACAAACTTCACTCTC
CCAGCTCCCAAAAACCGCTGCTAAAGAACTCAACTTCAGCAGGTTGTCCAGCTGCTCAGT
AAAGGAGTGGGGCTTGCTATCTGCTCCTTCTCATAGATCTTATTCATCAAATCTATTTTA
ACAGGTTGACTTAGGTGCTGAATGTTTTCAGGGATTTGTCAAATAGCAGAACTCGTGGAC
TGACTGTTCTCAGTGAAAGCCTAATCAGAACATTCGTCCTCTATCCATCCCGGGTACTTA
GTGACTGTCATGTTTTGTTCTGCAGGAGTGTTCTGAGCGAGCCGACCTCCTACCGCCCCA
GGCTGCTTTTAGAGGGCCGGCCAGGCTCCGGTCAGACGTCCCACCTCGCTCCTGCTGTCC
TACACACTCTGGAGAAATTCCCCGCGTACACCCTGGACGTGGCTGTGCTGTTTGGATCCA
GCGTAACTGCTCCGGAAGAGTCGTGTGCTCAGGTGACAAAAGTGACAGATTTCTCTTGAC
TCGTGCGTTTGTTGGAGTAGAGGCGTTCTCCTGCAGCCTTGTCAAATTCAGTGTCTTCTG
AAAGTGGACGTCACTGGCCAAAATGGCTGCCACAGTAACTGTCGTTCATGGGCCCTGCCT
CCCCGCATCAAGTGGGGATAAATATGTGCTGCAGACATTAGCCAGTTTGCTAACTACTAA
TATGTGGACTATGGCTTTTGATAGTTAAGGAGAGAAATAAGCTCAACCGCACTTTAGCGT
CCTATGATCATGGTCCTTTTGGCATGTGGATATTTTCCTCACCGTCCAGTTTAGACGTGA
ATGAAGACTGTCTCTGCACGTGTGTGTGTGCGGTAATCATGAAATATTAAGGCATTTGAC
TCTGCTGAGTATATACAATGTTTTAATTTGTTGTTTTCCCAAGACAAAAAACACAACACG
TGATCCATTTCTGGGTTCTGAAGATATTTTAATTGATTTAATAATAGTTTAATTGATTGT
ATTGAATTTCATTTAGTGTTTACTAGTGTTCTCCCTAAATTTGATGCATCATTATCTGTT
CTGTAGATCTTTGTCGAAGCGAAACGCACGTCTCCAAGCATTCTATACGTTCCTCACATT
GGACAGTGGTGGGAAACTGTGAGTCCGGCCTTGAGAGCCACCTTCCTCAGCCTGCTGAAC
TCCATCCCTGCCTTCGCTCCTGTTTTGTTGCTGGCCACGTGTAACATGCAATATAGAGAG
CTAAACATGGAGGTATGAAATGAAAACAGTGTTGATAGACTTTTTATGAGTTAATAAGTT
CAGGAGAGAAGTGTAAAACTGCTCTTTAAAGTTTCCTCTCTTTTCTTAGTTGCAGGACTT
GTTCAGCCTTGAGGACGAAGAAGTTTTCGGCATTCAGCCTCCCACCTGCAGAGAAAGACA
CAACTTCTTTGAGGATCTGATCCTTAATCAGTCCTCCAGAGCCCCTGCCTCGAAAAAGAA
AGCTGGTGAGGGTCAAAAATACATAAGTGTGAGGAGATGGATCGAAGACCTGAATTGGTT
TTCTGTGACCTGCTGTTGAGGTGTATTTTTGAGCAACATTTTTATTGCAGTTTGTATTAT
TGGGTAAATATTTCAAGAAGCATCGAGTGTGTTTGTTGTCACACTGGTTCTGGTGCAGTT
GAACTTAATGATGTGTGCGCACCTGTCATCCGTGTGTCTTCCGCCTTCAGTGATGAATCT
GGAGGTGCTCCCAGTTGCTCCCCCACCTCCCACACATCAACTGACAGAAGGAGAAGCCAA
ACGGTTGGAGGAGCTGGAGGAAGATACGCTGAGAGAGCTCCGTCTATTCCTGCGAGACGT
CACCAATCGCCTGTCCCAAGATAAACGCTTTAAGGCTTTTACAAAACCTGTTGATTTAGC
AGAAGTAGGTTTCTGCCCTTACTGATCTGGATTTACCAAAAAAAAAAACAAAAAACAACT
ATTTATTTAATTTCTTTCTTCAGAACAGGGTTTTTTGTGCTACTATCATTTTACTTACAT
TTGTTTTTTGGGCTTTTTTTTTTCTGTTTTTAGGTACCAGACTATGCAGATGTGATCAAA
AAGCCCATGGACCTGTCAACGGTCCTCTCTAAGATTGACCTGCATCGGTATGGCACCGTC
AAAGAGTTTCTCCAGGATGTGGATCTCATCTGGCAGAATGCCCTCGAGTATAACCCGGAT
CGGGACCCCTCAGGTACACACACTGTGGCGAGTTCTAACACCGGAGATGAGGGAACCGGC
ACTTTGGTTGGTTGGTTTGGTTTGGTTTGGTTTGTTTCACACAGTTGTGTTCTGGGTCTA
GATCGCCAGATCCGCCACCGAGCGTGCGCGCTGAAAGACACAGTCCACGCCATCATCAGA
TCTGAACTGGATGAAGATTTTGAGCGGATTTGTGAGGAGATCAAAGTGTCACGTACAACA
AGAGGTAAATGTGTGTGTGTGTGTGTGTGTGTGTGCACGCATCTTTTAAAAGAAAAATGC
TGTGATGGAGGTTATGACCTATGGTGATCCTGAATGCCGTTCTAGCTCTGCGGTGGTCCT
AAACTCAGCCTCTCATTTTATTGTGGGACCTTCTTATTCGTATTCTCTCTATTATTAGAG
CAGTGGAATATTATTTTTCCACTCAAAGTAAACCTGCTATCAGCAAGGTAATCAATTTAA
GAGGGACTAAATTTGCAGAAAGCGTCCTGTAGTTGTTGACATGGTGTAGATTTTAAGGCC
ATAGAGGCATTTTTAAATAGGGAATAATAGGCAAAAAACATTGATTTAACAGTGTGTGTT
ATCTTAAAAAAAGGATAGAGACCTTAGACCATCACCCTGTTGTTAATGACTTCAAAACTG
CATGAATGTGTCCACTGTGAGGAATATATAAAAATGCAGAGCTGCACTCGGAACCACACC
TGTGTTTTCATGGTCTCAGGTGGCTGCTCGCTGCGCTTTGCTCCCTCTTTCTACCATGTT
CTTCCCAAACCTGCTGCTGTTGCCAGCCTGACCCCACAAACCGAAGCCTCTGGAACCAAA
GCTGAGGTCACCCCCTCAAAGCCCTCCCCCGCCGTATTGCCGAAAAGCACAGGTAACTAG
TGCCGCAAGTCAGGAAATAATATTTCAAAGATAAATCCAGGTAAAAAAATCTTTTTTTTT
TCCGTCTCGGCAGGACAAAAGAGGAAGAGGCGGAAAAGTCGCTGGTCATCTGGAGTCTAT
GTCAAGAAGAAGCAGACTTCTCCACAAATTTCCAGAGAAGATGCACCCTTGGCAATTGAT
GAGGAAGAGGAGAGTGGGCATGATGAGGATGCTGAAAAGGGAGGAAGAGAGAAGCAGAGG
GCAGTGAATGTGAAATCAGGGTGGACACCAGCCAAAGGAGGTCTGGAAAGCCTTTCCACT
TCAGTGGACAACAGTCAGGAAGGTTGCGCGGGGGTGGAGAGAGGCAACCAGGAACCACCC
TGCTCTGGTAATATGGTTGGCGCTGAGAAAGAGAAGCTGACAGCAACTTGGAACAACATG
GTCCATGTGGAAGAGGAGGAACCGACCCCAGTGGCCACCCCAAGAAGAAACAGAAGCGCC
GGAGAGGACCCAGGCACAGGTGAGACGGCGTCATTACCGGGTTCGTATGAAACGCTGATG
CAGTACGCATGTGTTCCAGAGAGACTGCTGAGGTGCATGACTCATGCTAGAAAGAACACC
GTGATGCAGCAGCAGCCCATCAACATGGACAAGGCTGCGCAGGTCCTGGAGGAGGGGGAG
ACTCCTCCTCCTTTAGTGGTGGACAAGAACAAACTGGAGGTGTGTTTGACGGCTGCTGGA
CTGATTCTTGCCTCCCCGAGCATCACTGGCCACACGTGACTCTTCTGCCCTCCTTCCTGA
CTTTAGGCGCTGTTGGAAGAAGTGGTGAAAAAGACTGAAGGCTACGAGGTCTTCCAGCTG
GAGAAACTCTACGCTCGTCTCTGTCAGAGCATTTACAGACACAGGTGGGAGTACAACAAA
ACAGCACTTATAAAGGTGAGGACCGACGCCGTCGTTTCACTGCACATGTTCTGACAGCCT
TAATATGTTGAGAGCATCAGCCCTCATTCAGCCTTTGGTTTTTCCTGTGCCATCTGCCAT
CTATACAGGAGTTGGAACAAGAGATTGAAGACTTCTGTTTACCTTCTCTGGGAACAATGA
ACAAACCTTAGTTCCGTTGATTTTTGTTTTTTTGGGATATTTTTATTAAATATACACAGC
GCACACACATCTGCTCATACACAACAAAAAGGAAAATAAAAAAAATTAAAAAAATTATTT
CCCCTGATTACTTTTAATTTGTGATTGAACTTAACTTTTGTACCCATCTATTATATTTAA
TTAAAATAATTCTCTGTCAGTAACGTTATATGTTTTTTTTAATGGGATTGATACGTCATA
ACTGATGCAGATTATTTATATAAAAATATACTAGTATATTACCAGTGTTGTTCGTCTGTT
TAGGAAAATCAGCAGATAAACAAATATTCCATAGTGCTCTACAGTGAAGATGTAATCCAT
CTGGGAACAATGTCTGAATTCATCTCGCATGTTTTTATTCCTGCATCAGAACTTCCACCT
CAAACCTTCCCTGTGTGATTTCATGCTGCTTGTCTTCACCACAAACACGCTGCTTATTTA
GTCGCCTCATTTCCTCAGCTGACATTTCGCCTTCTAATTCTTTACCACTGCTGGAATGGC
GCTCCAATCGTTAGTTGCATTGCTTTAAAGCGGGCTGAAATGCCAGATTGTGCCTTACAA
ACCCCCCCACCGAGAACAACAATGCGAGGTTTGGAGCGAGAAGTGAACTTTCGCTGGGAG
CACCAGGCTTGTCCTCGGATAACTCCTCCAACTGCCCCGGCGGGTCATGTCGGGACACGC
TGGCAGCCTTCCCGGCTGCGCCGCGCCGCGCTCCGCGCCGACGGCTTTCGTCGACGCACT
TTCCTCTTCGCGGAGGTGTCAAACGGCACAATGGGCAGTTTTTACATGGTGTTAACATTC
AAAAAAGACGATTTTTGACTACATTTTCGATGTAGAAAGCAGAGAGAGAGTCGCCGAGCA
ATGACGTCAGGACGTATCACATTGAACGATGACGCCGTTCGATCATTAAAAAAAAAAAAC
CTGCCTTTAAAATACATCACAAAATGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1104, 1394..1475, 1604..1737, 1911..1990, 2208..2325, 2890..2991, 3094..3202, 3359..3474, 3681..3855, 3995..4083, 4153..4322, 4401..4496, 4597..4774, 4858..4994, 5078..5210, 5425..5611, 6186..6371, 6469..6604, 6830..7023, 7173..7332, 7441..7563, 8059..8211, 8293..8437, 8519..8918, 9006..9134, 9248..9286
1002..1104, 1394..1475, 1604..1737, 1911..1990, 2208..2325, 2890..2991, 3094..3202, 3359..3474, 3681..3855, 3995..4083, 4153..4322, 4401..4496, 4597..4774, 4858..4994, 5078..5210, 5425..5611, 6186..6371, 6469..6604, 6830..7023, 7173..7332, 7441..7563, 8059..8211, 8293..8437, 8519..8918, 9006..9134, 9248..9286
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved