Tetraodon_nigroviridis Locus Poly:SNORD111
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD111
Tetraodon_nigroviridis
Poly:SNORD111
7
SNORD111, SNORD111
1001..1083, 1864..1945
3083
CATGCTGTGTTGCAGCACCACCAAGTGGTGGCACCTTCTCTCTATCGGGATAGTAAGTG
ACAATGGTTGACTGCTTTGCAGTGTAACTGATATATTTTAATTGTTTTAGTTCATTTATG
TGGTTTACCTGACAAAAAACTCCAGTTATTTATCATAAGCATCCTCATTCATTGACATCC
ATCATTTTGGCTTTTGTCACCCTCTAAAAGTAAAAAAATATACACACGACAAACATAGAA
TAACTAAGAATAGTCGGGCATTAGAAATTGTCTTTATAAGTGTGTCTCTTTTGTCATTTT
TGTTGTCAGATTATTGAAGTTTTGGGTAATACAGATGATTGTGGGTTAATTGGGATGTAG
TCAGTGCAGTTTAGCAGCAGTCAAAGTTGGAAAATCATCCGTATTTCCACCGTTTCTGAT
CTGCGACATTCAGATATTTAAATAAAAGTCGGCTTCAGTCGGGTGAATTGGCCTCTGCAT
GGCCGAGACTCACCCGCGTTTCCTCACACGCTGAGACCATGTTTGGTGACCCTCAAAGCA
CAGGCCCTCCAGTGCAAAACAATCAAAAATACAAATGCATGTGTGATATATGGTGGATGT
ACAGGTTAAACATTTATGAGTACTTAGCTGTTGTTTTGTAATCGGGCGTCCCTGTGAGGT
CATAGATCCTAAACGTCTTTCTGGACTCATCAGAGATGTTAATGCTTAAAATCATCAATG
TCAGCAGAAATGAACCCATAAAGTAAATAATCTCATCCATTTTGTCTCCAGGGTCACAAA
AAGACGCTGACAGCAACTAAGAAGGAGTCAAAGGAGAAGAGGGAGATCATTGAGGAGAGC
AAAGAGAACCTAAAGGCCAAGTCGGACGACTCCGGAGAGGAGAAGAACGGCGACGACAAT
TCCCAGAAAAACGGGTCAAAGAAAAAAGGTCAGCGTAGGTCATGATGATGACGTTTGTGT
TGGTGTCCAGAGAGGCTTTAGCAGCAGGTCAACCTGCAGATGTGCTGTAAAGCTGATGAG
TTTTCATGTCTCTTCTCTGACTAAACATCAATGAAGAGGACTTTCACCACTCTGATCTCA
GCATTGAGTCTAAAGAAATAAGAGGCCTCCAATAATACGTTTCCTTACATCACATTAGAA
TATTCATATTTGATGGTACAATTACAGATGATTGCTCCTGTTTTATTGAGTTCATGGCGA
TGGGAATTGGTACTCTGCTTGAAGCGGCCAGTGATGCCCTCTGCTGGTTGGTAGAGGCAA
TGACTTGTACTTCCTTTATTTATTTTTATTATTTTCATACCTTTTATTATCAGGAAACAA
GCAGAAATGGGTTCCTCTGATGATTGAAGTGAAGTCGGAGGGCCCCAGAGAGCGCTCGGC
CTCCAGGAACAACAGCAGACAGAACGAACACCCCCGCCTCCCCCCCAATGCCAGGAACGA
CCTCAGAGGTCAGTCTGTGATGTCATAACTCAGTAGCATCGTCATGCTGTGGGCTGTAGC
AGAAAGTTATCCCGCATGTGTGCATTTTTGTTTATGGAATTACGTTAAGGTGAATTTTAA
TGCTTCTTCCCAGTCGATACTCTTGCGTTTGTGTTTGTGCTGATTGGAATGTTGTCATTG
TCCACATAGACTGGCACAGTCAAAAGTATGACAAGGAGTGGCGCGACGACCACGATGAAG
TGTCGAGCGTTAAGAGTGAGGGGGCGCCATTCCGCGGAGGGTTTAGAGGTCGCGGGCGTG
GCAGAGGAAGGGGGCGAGGACGTGGCAGAGGTGGTGCAAGAGGTATGACGAAAGGATTTT
CTTTACGCAAGCAGCCACAGAGCTAAGTGTTCTGGACGTGTCATCAGATCCGATCTGTCG
ACCTTGCTGTGGACGTGATGAGCTCCTCATGTCTCTTCTCTGAATAAAAACCAATGAAGA
GAACTTTCACAACTCTGATCTCAGCATCAAATCGGAAATATGAGCGTTGATTCAAGACAG
TACTAGTAGCAAAATTAACACTCTAAAAATGTGTAGTTTTAGCCTGAAGCAGTTTACATT
AAACATCAAAATACATTGTTTGTTACCAGGGACAGTTTAAAAAGTAGGGTAAAAGCACAT
AATAGAGGCAATTTTCAGTACTTTATTAGCTGGAATGTAACAAGTGGGTTTTTATGTACA
TGTCCTGCTAAAGTTGTTAAATGTGGTATTATCACTCTTTTTATGTTTATCAGATGTTCT
TATGTCATGTGATAGCTGATGGGTTGTGCGTGTGTTTGTTTTTTACCCACAACCCATAAA
TACTGATGAAATTACTGTTCAGCCATTAGTGGAATGGTTGGGGGATCTTTCAGTCATGTG
GTTCTTCTGCTAGAATGTCAGAAACATCTGGAGTAGGCCAGATTAAACAACAAAATAACA
AAATAGTTGTGATGATGCATCCAAAAAGTAACCCGTGTGCTGTCCCGTCAAGGCCACTAC
GACTACGGCTATGGCTACAAGCCCTACGATGGAAAAGAGTCCCCCTATGGCCAGAAGTTC
AGCAACACGGTGACCTACTACTACGACAACATGAGCAGCAACGACCTTTACTCAGTTGAC
CACGATGTTCTGAAAGACTACATCAAGAGACAGATGTGAGTTGAGGTCTTTTTCCCTGGA
CGTGCAGAACGTGGGCCAGTTTTCCAGTTCTATTTTTGGAATGAAGTTGAGCTCGTGTTT
CTGTCTGCAGTGAGTACTACTTCAGCCTGGACAACCTGGAACGGGACTTTTTCCTGCGGA
GGAAGATGGATCAAGAGGGCTTTCTGCCCATTGGACTCATCGCCAGTTTCCACAGAGTGC
AGGCCCTCACCACCAACATCGCCCTTATTGTAGAAGTAAAGACATTTTCTTCTACTGTGG
AGAAAAATCTTAGCTTTCATTTTCTACTTTATAGTTGCATTTTTTAAATATTTGCTCAAA
GACACTAAAAAGTTCCTGATACAGCCTTTATGCAGAGATGTGGCATGTTTTAAGAGTGGT
TTTCCCCTGCTAGGCTTTGAAGGACAGTAAAGAAGTGGAGGTGATTGACTTGAAGATCCG
TCGGAAGGATGACCCTCTGAAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved