Tetraodon_nigroviridis Locus Poly:SNORD65
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD65
Tetraodon_nigroviridis
Poly:SNORD65
7
SNORD49, SNORD65, SNORD49, SNORD65
1001..1069, 1224..1297, 1535..1609, 1763..1836
2836
ACAACAATATAACAGTAAAGCTTTCCAAAGTTACCTGAAGGTGCTGCATAGATGTCTCA
ATGGGTTCCGACTCCGGAGATGTGATGTCCAAAGTCTGTCAGGAAAACAGCTGCAGAAAA
ACGGACACAACCACCCTGAGACCAACATTCAGCTAATAAACGCTCGTCCAATTAGAAACC
AGCGCGTCCCCGGTCTGCTGGTGCCGCTCAGTGGTGGAAGATATTCTAACGTTCATGAGT
TCAGCGACCGGCTCCATCAGCAAACTAAAGGGTGAAAAAAATAGTGAGTTTATTAGGCAA
CGCTGTAGTTATTCTAAATTGGCTGCATCGTATAAATTAATGTATTTACAAGTTTAATTT
TCACAATTAAATGAGACAATCTTCAAATGAAGATATTTGTAATTCGCCCTTACTACCGTC
AGGGGGCGACAAAGACCCCGCTCGACTATGCGCAGTCGAGTGACGTCATAACTCCGCGAC
ACGAACGTATAAAAACTTAGCGCTTCTGCAGCGCGGTCTCTTTTGCCTCTTGTGAACGTT
GCAGAATGTTGCTAGCGGTTTTCTTTTGTGATGTATTTGATGAACTACTTTCTTTTCTCG
GCGTATTGTATAAATCTCTACAACAAGTCGGTTTTGAACGAGTTTCCACATGAAGTTGTT
GACTGCTAACTGAAACATGGTAACTTAGACGCGACGCGAGCAGGCACGTGGTGCAGCATG
GAGCCGAGGTACGACTTCTGCTGACTGCAGAGGACGGACATCTACGTTTTTATTGGGATT
TCTATTGCACAGATTGTCTAAGGCTTCATATTTAACGCTTGCCTTCGTGTTTTCTTAATG
GCGTTGAAGGAACCTTCGTAGTACCTGCGGTAGTACTTTATGATGCCGGGTACCTTCATA
ATGGCGACTTCTGGGTTGGTGAGAAGGAAAAACTCCTCTGGGAATGTTGCTCTCCTCTCC
AAAGGTGGGTAATTCATCGCCACATAATTAAAATTATAATGGTCAATGATGAAAACTAAT
AGGAAGTGCCGTCTGATGCGATAACTGACGATGTTTAATATTCACCGTTCTGAGGCTCAG
ACTTCTATACTTTCATTGTAGATCAGTTTTCTTCACCATTTTAATTGAATTTGTTTTCTT
TTAAGGAGTAGCTGCTTCCTGAATGGCGGCCTTTCCACTATCAGGTTGGTTTAATGAATG
TACATTAATGTGCAACCCCGAATGTTCTGATGAAATAGAAACGGAAATAGCTGGAATTAC
CGGCAGATTGTTCAGTGGTGATTCTCTGTTTTCTGAACATTCAATGGTTCGATTTGCTGC
CTTTTTCCTGGAGTGATGTTAATAATCTAAAAAACCTTTTCCCTTCAGCAGGAAAGTGAA
GTCCTGGGTGCAGAGTCACAGATGGAGGCAGACGGGGTGAGTCCGAAGAAGCATCAGATC
TGACCTGCTTCTGCGATTCAAAATGAGGCTTTTTTAAAATAAAATTGACTGTAACGCTAG
TCTTTGCACAAAAATAAAAGAAACAACTTGTCAAGGTCAATGATGAAGTCTTGGAGTAGG
AAGTGCCGTCAGATGCGACAACTGACGATTTCTGATCCACTTTTTTGAGGCTTTTGCTTG
AAACCTTGACTGTTTTCTGGCGTATTTTCCTCCTCTGAACCTCTTTTTGCCTCCTAGGTG
TTGCTCCGGCGCTTCAGTGCCCTGACGTCCGCTGTCTGGATGAAGGTATCTGACACGTCC
TCGTTCCCGCCGCTTGTTTGATGTGGTGATGAAATCTAAACTGAAAATGCTGGAATTACC
GTCAGATTGTTCAGTGGTGATATTTGGTTTTCTGAACATCGCCAGGCTGCGTCATCGGAC
GGCTGAACCAAGCAAGAGATTAAAATCCTTCCTTTCCCATTCAGGTTTGAGAGGCCCTGA
AGACTCTTCATCCCTGCGGTTCCTCCGCTGGAGGGACCAGCTCTGGTGCAAGAAGCCCTG
CTGTAATGTAGATACATTGGTTAATAAACACCTTAAAATGAGAAAATGACTGTCTTTAAA
CTTCTCACGGGGGTGAGGTTCAGCTTGGTTGCGGGTGCTTCACAGCTCCAACCTAAACCT
TCTTTCTCCCCTGATGGGAGGATGGAGGTGTTGGTCTAGGTTTCTCCACCTGGGGGCGCT
GTGGTTCGCCTTTGACACCCACCAGTTTCCCAAAGCGTCAGAACGTAAAGATCCAGTAAA
TTCCAAGATTCAAGCATAGTTCCAGATAAGAAACTCAAATGAATCTGGTCATCTCGTTCC
TGGGAAGACTTAAACAGGCAGCATCTTGTCAATTATTTCCTGAACTATGGGAGCACCGCC
TGTTTACAGCTTGTATATGCTACGTGGCCTGATGCAATAGACATTATAAAGATTTAAAGG
CTAAAGCAACAGTATGTGTGATAAAAATCCCAGATTAAACTCATAAGGTTGTTTCCAGTC
GACAGCTCCTGGTGCCACAGTCCAGAAAACAGCTTTGTGCCTTTTACCACCTGATAAACT
AGGAAAACATCAGCTCAAAAGGGGAAAGCAAGAAACATGACAGGTTAGCCTTGTTATTAC
GGACTAGTTCTTCCCCTGAGGAGGTTTGTGGAGTGCATGATTGCGCGCCTGGAGCTCCGA
CGCACCACAAACCCGTTTTAAAGGGCTGGTTTGTGCGACTGTTGGCCCAAAACCAAACCT
GTTCATCCCAACAGTTTGAATGACTGCACCACAGGCGTCTGGTAATGTGAATATACAGTA
AGTCATCACTGCCTTGACATGATTATGGCCCCTTTTGTTTCAAAGGCATTGTGGACATGC
GTGTAACCTGCTGCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved