Tetraodon_nigroviridis Locus ddx52
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis ddx52
Tetraodon_nigroviridis
ddx52
7
SNORD42
6938..7008
8137
ACTTCTTGTAAGAACTTTAAAGTACGGATCAAATCTGCTGCTGCCCTGGCGGTGCCCGC
TGAGCGCATCTGTTACGGGGACACAAAGAGGTTCATCGCCGTGTGGCGTTCCCTGGCTAC
AGCCCTTCAGAACAGTGATGACACCAATGATTTCTTAGAGTACCGCTTCAGCGCCAATCT
GCGCCACACACTCTCGCAAGCTTTACTCCACCTGCTCAGCCTTAGCCAGGCAGAGGACAT
ACCTGCTCTTGGGGTGTCACTGGCTGGAGAGGAAGGGGAAAGCATCAGAGAACATGTGAT
CAAATATATAAGAGAGGGGGAGGGAGGAGGCATTGTGGAACAGGGAGAGGAGGACGCAGC
GGGGGAGAGTTTCACTCCTCAGCAGAGAGTTGGAGGTCTGCAGCAAACCCTAATGAGACT
GAAAGATTTAAAGGCTGAAGGAGAGGGACAGGCTGAGCAGGAGAGAGGAAAGGCAGTGGT
TGTCCAGTTCTTGGAGGATTTGCTGAAGGCCTGTGAAGAAATGTGAGAGAAGTAGTGAGT
TGATGAAGACTGAAGTCTGGTCTAAAGATGGACAGAGCAAAGAAGAAACATCTAACATAA
ATTACAGTGAAGAAAAAACATTGTCTTGGTGCAAAAGGCAACTATGTACCCAATTATGTT
TGTCTTTTTTTTCGGCAACAGTTTTAGATATTCAGCAAATATTGCACTTTTGTGACATTC
TTGGAATCGTGTTATAAGAATTACAGTTTTCAAATTAAAATTGCAAAAAAACATAAACAA
GTGTTGGATATATAAATCTTTGATTAGGCAACGGCATGATTTTGAATTAGTTGATAACAA
ACAACACGTTATTTCGATCAGACCGCTTGTTCTGAGCGTATCCGTTAGGGGGCGCTATCA
TTTAGAACGCAGGGAGGACGCCGAGGGTGAATGATTCCGGTGTTGATTTTTAATGTCTGG
CTCTGGCGGACCACGCCGCCGCTGCTGCTGCTGTAGCGACTATGGACTCCTTTGAATTGT
TTCGAAAGCTCGGAGCTGGGGCTAAATTTGACTTTAAAAGGTTTGCTCAAGATGCAGCCC
GGTTTAAGGTAAGGTAAAACGTCAATAGGATAGTGACTGGAACATAAATGACTGGTATTA
GCTGCTGTTTGCTGTAGGCTGACAATTTCAGTTATGCCCCAGCGATAAAATTATTGGCAT
TACTGTGTATTTATGGTACGTTTGAACATGTCACCGTTAATTAAACGCGTTTTACAACAT
ATCGAACAACGACAATCATACTTTGTTGGTTTATTTTACAGGTCATCAGATCTCATGGCG
TAAACCCGTCCACAGATCATCTCTCTGCCATCGATTACTTTAGTTCAGGACCAACTAATG
GAGCTCAGATCAGCTCTAACGCTGAAAATGACCGTCTGGAGGAGTGTGAAATGGAAAGTG
CGGATTCTGGGGTAAAGGGAAAAAGGAAGCTAAAACATGTGAAGAGAGACGGGAAGATAA
ATAAGAAAAAATCCAAAAGAGACCAGATGGACGTGGACGGTAATAGTGCAGCTGTATTTT
TGCATACTAAAACATTTTACAGATAATTATTTGACTCAAAGCAGTATTGGTTAATAAGAT
CTACATTTACATCTAATGGCTGTCTGCTTTTACATTGGTTGATTCTATTAATATTTACAT
GTAATTTACATGCAGTTTCTAAACTATCATTGTAAACCAACTATGATTATATTCTACTGC
CTTATGCCTAAATGTAGACATTGTTTGATTGGGAAGCTCATGTTATCGCTTTGTAATGAC
AATTGATAAATTTGGTGTGAAACAATTCTTCATGGTCTCACTATGCTATTTTGTGTCTAA
CTGCAGGTGATTGCAATTCAAAAGACAGTAATGCAGACATCACATGGACATCCTTGTTGG
ACAGGAAGGTCCACAGCCTGGCAGCTGACGAAAAAGAGACTCTTTCGCTGAAGAGACTGA
AGCATCTTCATCAGGAAAAGGTCCTCAGAAATACACTTAATAGCTGTTCTCATAAAAACT
TCCCCCCGTTGCGGTCCTTAACAATATCAGTAATTTATTTTATTTTTAGGTTAATCGGAT
TCGATCTCAACACCGTATAAATGTGCACGGCTCCGACATTCCAGACCCTGTGTGTACATT
TGACGAGCTGCAATCTGAATATCATCTCAATGCCCGTATCCTCCAAAACCTCAAAGATGC
TGGGCTGAGCTCCCCAACACCAATTCAGATGCAGGCAATGCCACTAATGATGCATGTGAG
TGGGAAAGAATGCAGGCTGAGCGGTGTATATATGCTGTATGGACATTGCTTTGTGAGCAT
CTTTGTGTTCCGATCAGGGTCGGGAGCTACTGGCGTGTGCTCCCACGGGATCAGGAAAGA
CGTTGGCTTTCTGCATTCCGCTGCTCGCCCATCTGCAGCAGCCTGCTAACCTTGGCTTCA
GAGCTGTGATCATTTCTCCAACCAGAGAGCTAGCCAGCCAGGTACACAATATCAATCTTT
ATTTGTTTCTAGGAGAAGGTGATTTTAATATAAATTCATACCTTCAATGCATGACACAAG
GGTGTATTCCTAAATCAAGCATTTATAAAGAATTCTTATAATTAACATCAACATAACATA
ATGAATTTTCTATATTTTTTTAGACCTACAGAGAGCTGCTGCGCCTGACAGACGGAGCCG
GATTTAGAGTTCATATCATAGACAAAGCTTCTCTAGCGGCAAAGAAATATGGACCACACT
CAAACAAAAAATATGGTATGAAAGGGGGAAAAAAGAGAATGCTGATTAGGCAGATAAAAA
TAAAATATGAATAGCCTTTATGTTGCTTTCTACATTTTTGCAGATATACTCATCAGTACC
CCAAACAGACTCATCTTTCTCCTCAAGCAAGATCCTCCAGCTCTTGACCTCAGCAGGTAA
CAGAAAATCTGTAGGAATGTCAACGCCCGTTTCTGGAGCTGTACTTGGGGGGGGGAAAAA
TAGTATTTCTTTGATTATATATATATATACTTGGTGAAAACACAGCTTGACTGTTTGGCT
CTGTTCTTCAGTGTGGAGTGGCTGGTCGTTGATGAGTCTGATAAGCTTTTTGAAGATGGT
AAGACGGGCTTCAGGGAGCAGCTCGCCACCATTTTTCTGGCCTGTTCTGGCTCAAAGGTG
CGCCGGGCTTTCTTCAGCGCCACCTGCACATCCGACGTGGAGCAGTGGTGTCGATTAAAC
CTTGACAACCTTGTGTCCGTTAACATTGGTCCCAGGTAATAATCTACCTCCCTAATAGCT
TTCTTTGGCTGATTTATTTTAATGGACGTAAAGAAAAATGCAATCGTGATCTTCTCAGAA
ACACAGCAGTCGAGACGGTGGAACAGGAGCTGCTGTTTGTTGGGACGGAAAATGGCAAAC
TGTTAGCCGTTAGGGAGATCATCAAAAAAGTAAGGAAACCCAGAGGGGCCTGCATTTCAT
ATTATTTTGACGCCATAATGGATCGTAAATCAACTGGAAGGACAGAGGTTTTGAGACTTG
TCCTGTTGGGATTTTCAGGGGTTTTTGCCACCCATGCTGGTATTTGTACAGTCCAAAGAA
CGAGCTCGAGAGCTTTTCCATGAGCTGGTTTACGAAGGCATCAATGTGGATGTGATCCAT
GCTGAACGCACGCAGCAGCAGGTACCAGGGCAAACAGCACATCGGCTCACGTGTTTATAG
AGCTCCTTGGCTTTATTGACCTTTTTCTTTTTCCCACCAGAGAGACAACGTCGTGAACAG
TTTTCGTTCAGGAAAGATTTGGGTTTTGATCTGCACAGCTCTGCTTGCCAGAGGAATTGA
CTTCAAGGGGGTTAATCTTGTTCTCAACTATGACTTTCCCACCAGTGCTGTCGAGTACAT
CCACCGAATTGGTGAGTCTTTACTCAGCTGGGGTTTTAGTGAGAGCATTTCTGTTCCTAA
AAAAAGTACCAAGAGAAAGGAGCAGGAAAACGACTTTTTGAAGGTTTTCAGCAACAAAGT
TGATTTTGCACACATTTGTCTTTCTTCATCTGATTTTCTGTTATTTTACCTTTGTTCCAA
AGGTCGAACCGGTAGAGCTGGACATAGAGGAAAGGCCATCACCTTCTTCACAGAAAATGA
CAAACCGTTGCTGCGCAGGTACATGCACATTAGTAATACCATACCATAGGGCTTTGGACC
CCAGAAATTCAGGTAATTTTAGATTTCTTGATGTAAAACCATTTATAAGATTTATTTATT
TATTCAAATTCAGCATCGCTAATGTCATCAAGCAAGCTGGTTGTCCTGTGCCTGACTACA
TAACAGGCTTCAAGAAGATACACAGGTAAATAACTGATAACAAATTTATCGATTAATTTC
ATTATCTTGAGATGATTCTGAGCATTTGTTTTGTGTTACATTCAGCAAAGTGAAGCGGAG
ACTTGAGAAAAAACCTCCCAAGCGCAGCACCATTTGCACCACTCCTCGTTTCTTGATGAA
GAAGAAAGGAAAAGCTGCGAATAAAAGACAGAAAGCAGAAATACAGATGACAAGGGTGGA
AGAGAGGAAAGAAGAAAGCACATCTCAAACAAGTGTAGTACAACAGAAGGTTAAAAAAAA
TAAAACAAAGAAAGAGCAGCAAGGAAAAAAAGACAAAACATTACAAAAGAAAGAATCAGG
TTCACCTGGAGACAAGTTTAAGAAGTAATTATTTCTTTTACTAATGCAAACATGGAGCAG
TATAATTACTTTTGCTATTAGTTCTGTTATGTAATAGTTTAACATTTGTTCTTCTTTATC
CACCAGAAAAATCAAGAAAAATAAACCACAAGAGGAATGAAGGCAGCAAGCTGATCCTAA
AAATTAACATGGATATTTTTTCTTCTTTGTTGTTATTTTTCTACAATTCTGTGCTCAGAA
TAGTAAAAAAAACCCTTTTATACACTGTATGTTGTATGTTTGCCTCCCCTAAACAGCAAC
TCTGGGGTTGATAAATCATTAAACTATGTCAAACCATTCATTCTAACGAAACCGGTGCTA
AGAAAGTGGGCATTTAGATAACGTTAATATCAAGCCTGTGGCGGTTTTCGAAGAAACTTT
ACACAAGTGTAGTTGAACACAGATATAAACTTGGATAACTATGATCTGGATGAATGAGAA
CCCACACGGACGCCATTAAATAATGTGCTAAGAAAGTGGGCATTTAGATAACGTTAATAT
CAAGCCTGTGGCGGTTTTCGAAGAAACTTTACACAAGTGTAGTTGAACACAGATATAAAC
TTGGATAACTATGATCTGGATGAATGAGAACCCACACGGACGCCATTAAATAATGTGCGC
TGACAGTTTAACTATCGCGATATACGTGCGAGATCTCGCCCATGCATTATACCCCAGGAA
ACCCCGCTCCGTCTTCCTTTCCCAACATGGCACCAAAGGCGAAGAAGGAAGGTCTGTCAA
TCTCATATTTTAGACTGATCAAAGTTAGCAGTTGGCCATAAATGTATAAGTTGTAATGCT
TCTACAATAATGGAGCAAAAGCCAAGATGATCGAGACGGCATTACTCTGAAAATTTAACT
GAACCGGATCAATATAACGCGAACAGACCGCGTCTCCGGCATGTTGCTTGTAGGTAACGT
GATGCTAGGCTAACAGTAGCACAGTAGCAGTGACCGTGTGATCTACTAAATTATTCTGGT
ACAATTGTTGCAGTAATGCCTTTAATTGTCTCAACTCGGCCATATATATGACTGATGCGT
CAATTCTTGCCTCATGTCTACGGCTAAGCTGTACTGGAAACATTAGCTACACGTGAAAGC
TAGCTGGTTTACGGGACCGTTGCTTTAATTCCTAAATATGTTCATGACGTGACTTAAATG
GCTAGTTATTTCGTCTGCCGCATAATGGATGTAACGTGATGTTTATATGGTGTTATATGA
TGTTATGTGTCTTTAATCCAACCGGAGTAATTTCAAGTGCCATGCTAAATGATGCCCCTT
GCTACACGCTTTTCTGTATGTCTTCAACACGCATGTGGATATTGCCACAAATCAGCCTTA
TTACTCTATCATTTTGTGCAATCCAGATTTCTTTAACAAAGCTGTCTCCTTCTTTTAGTG
GTCCCTGCCAAGACTGAAGCCAAGTCAAAGGCCCTGAAGGCCAAAAAGGCTGTGCTTAAA
GGTGTGCACAGCCAGAGGAGGAAGAAGATCAGGACCTCTCCGACCTTCCGCCGCCCCAAA
ACTCAGCGTCTGCGCCGGCAGCCCAAGTACCCTCGCAAAAGTGCTCCCCGGAGGAACAAG
TAAGTTACACCGACAGCCACAAGAAAGGCAGAGACCTGGTGCAAATGATGGTAAATAGCG
ATCAAAGTATGAAACAAATGATTCCACATTTTAACTACTGATGCACCAAAGACTGCAACA
TGTCAGCACTTGTTGTTAAGAAAGTAAAGGAGTTTGAGACCATAAAGATTAAATGTGTAT
CTCTTCCTCTTTAGGTTGGATCACTATGCTATCATCAAGTTCCCCTTGACTACAGAGTCT
GCCATGAAAAAAATAGAGGACAATAACACACTTGTGTTCATTGTGGACGTCAAGGCAAAC
AAACATCAGATCAAGCACGCTGTCAAGAAGCTGTATGATATTGATGTTGCAAAAGTCAAC
ACTTTAATCAGGTAGGAACAATGATCTAGTTCTTTTGGATTATATGTTTCCCTATAGGAT
TTTATCAAGTACACCAGTGTGGTGCCAACTCCTTGTAGACACATCCAGGCGTAAGCATAA
ATTGATCTTCTGTGTTGTGTTTTCAGGCCTGACGGTGAGAAGAAGGCGTACGTTCGTCTG
GCGCCAGATTATGATGCATTGGATGTTGCAAACAAGGTGAGACTTAGTGAAAGCTTTTCC
AAGTTAACACGAGATATTAGCTTTCAGAAGCCAGACCTGTGCAAGTGATGCAAACTTTTA
CTATAGCTGAATGTATGTGATGCATTCATCAAAGGAACCACTGATGCCAGATAGTTCAGA
TATTGGTTTATTAGGCCTTGATGAACGCCATCTAATTTACATGTTTTCCTTCTTTACAGA
TTGGCATCATCTAAACTGGCAGAAAAAAGGCTTGAATAAATATTTGTACTAACTAAAACT
AGTGTTGTCTGGTTAATGTGTTTGTATGCATTCAACTTTGCCCAACATACGTTTTGTTCA
TTTTCACTGAAATGCTGGATCACAAGTGTGACGAACCACTTTTCTCGGTTTACTAAATAA
TGGTTTGGAGGGAGTCTTGGGCAGTGTCTCGGTGTGAAAAGTATTTAAATGGTTTTTGGC
TTGTTAGAAATGATTTATTTACAGAGGCATGTTTTAGAAAGGTAACATTTTAGGTTCGCT
TTAACTGCTCTGAGCCGCTATTAAGGCCACAACAGATCACAGCAGGTATTATTTGTTAAA
TGTGGTCTTACAACTACTCCCTATAGTGGCAAATACCGAGATGTTAATACCAAGATTTTC
TACATTCACTGAAGAGCAGCACATGGAGGCCACTAGGTGTTAGCAATGGTTATAAAAGAG
CAGTTAATGAAATTGGTTAGACTATCTGGTTTGACTGAAAATAGAATTCTGAAATATTCA
TTAGTACATTCTAACAGTTGATGGGATAATGAAATTGACTAAAACCCTCTCAAGAGTGGT
TTGGTTACAGGTGGAGTCGGGCCTCTTCAGATTGGAAACAAGCTTTTATGTTTACGGTTT
CCAGCAACCATCCTGGGGGCTCAGTTATGAGAGGAAGGTCCGTACTGTGCCTTTCACCAG
GCCTCTGCAGATCGGGCACTTCCTTAACGACGGCGCGCATTCTTTGCACACCACCAGATG
TCCGCACGGGATGAAGACGATGTTTACTTCTTTATCCATACACACCTTACAGGTACGCTC
CTCCTGCAGGCGTCGCAGCTGCTCCTCCATGGGTAGGTCTGAAAAGGTTCAGGATCCAGA
ATTATTTATACAACAATATTTTGAAATTCAAAGATTTTTTTTTTTGTGGAAATAGCCATG
AAAACAGGTTTTGTATAACTAAAAACTGCTGTTCCCACTCCCACTGTTTCATAATACCTG
AGAGGTCTTGGCTAGGTGACGAGGCCTCACTTGACTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1087, 1301..1499, 1866..1999, 2089..2274, 2357..2500, 2663..2774, 2863..2935, 3071..3274, 3358..3448, 3558..3680, 3760..3910, 4082..4157, 4273..4344, 4425..4513, 6118..6298, 6494..6670, 6806..6875, 7079..7137
1001..1087, 1301..1499, 1866..1999, 2089..2274, 2357..2500, 2663..2774, 2863..2935, 3071..3274, 3358..3448, 3558..3680, 3760..3910, 4082..4157, 4273..4344, 4425..4513, 6118..6167
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved