Tetraodon_nigroviridis Locus gars
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis gars
Tetraodon_nigroviridis
gars
6
SNORA84
2057..2195
5909
TTAAAAAGACTAAGGAAACATTTGTATCTGTCATGAATGTTCATCTGATTACTGAACTG
CTTTCAAAACTCACAGAACACAAATATTTGCCAGCGGGTTTGGTTCTTTGAAAAAGTACT
CACATCTCTGATGGAAGACCTCGCTGGCATCTGGACTCCACAGGTTCCAGGTCACAGAAG
TAAAAGGCTCAGCTCCTAAAGAAGATATTTCTGTTAATGAATAATAAAAACGCCTGGAGG
ATCTTACAGTAATAACAACTCTGAAACAACTGAAGCAATATGTATTTAAAATTGTAAAGA
AAAAAATTATAACAAATTTTTCACGAAAACAAGAAAGTGGTTTCTGTTTTCTGCGCGTGG
CAGTAAGAATCACGTGTATGTGCTGCCACCTCGTGGTGACAATTTAAAACGCGGAACATC
CTTTTTTTTTACTTTAGCGAGTTGCTATGAATAAATTTGTTAAAACCAGTCGTTTCTTTA
AACTGGCGTAATGTTTAAAGGTACAATTACATATTCATGGCTGTATATAAAATGTCAGAA
ATAGGTAGTGACAAAAATGAAATTTTCACTTATAAACGCGCAATTCTACCTTCCTTGCAA
AAATTAAATTCTCATTTCAAACCAGAGTAACAGATTTTGCTGGGGCCTCAGCGGGACATG
ATTTAGCACTACTGCGTTGAAATAAATACGATACATTAAAAATAATAATTAAACCGCAAA
TATTCGCGTTAATGATTGCGAATATTTGCGTTTTGTTCTATGACGAATCTGCCGACGCGT
CACATGCCACGCCGGGTCGAAACGAGTGACGAAAGTGCTTCTCAGGAGCGGAAGCGGCAT
TCGCCTAATTCCAGCGATTTCATCATCCGCCTGTCGCATTCCCTCGGTCCATGCTTCGTA
GCTCCAGTGCAGCACTGCTGCAGACCTCCACTCGGGTTTCCTGCATCCGTGCGCTATCCA
CGGCCCGGCCCGTTCGGCAGTCGCTCCGCCACCCGCTCTTAAACAGGCCGTTTTCAACAT
CGGTCTGCTTGTGTAAGAAGAAGAAGACTAGCCTGTGGCTGCAGCTGGCGAAAGGACAAA
CCATGGAAGGCAACGTTGAGGAAATTCTCGCCCCTTTTAGGCTGGCTGTCAAAGAACAGG
TTACATTTACTGTCACTATAGTTGTGTGCCGGTTTGGAGTTGGACGTGCTTAAGTTGTTC
TTTACTAAGGAAATGCAGGGTCGCCCTGCAGCCCGGTTCATCTGACCGGCTGTTGGAAGT
GTCAGGATAGCGAGCATGCTAACTAGCTGCTAATGCTAACCCGCTGCCACGTTTTAGGGG
TGCGACTGCAGAGTTTTGGAGCAGGGTGGGGTTAGGAAGTGGTACTAATGACACTGCTAA
AAGACAACGGGGAGGTGGACCTAGAACCAGCTTTATTTAAATGGCTTACCACTCTCAGGC
CGTCTGTTTGTGCAGGGGGACCTGGTGCGCCAGATGAAACAGGATGGAGCTCCTGATGTG
GACGTAACCAAAGCTGTGGCTGAACTGAAAGCAAGAAAGAAGGCTTTGGAGACAAAGGTG
AGTGCATAATGTACATTCAGTGGCACAGATGAGCCATTTGAGCCCTTAAACTTGGTTGCT
TCAACTAAAGTTTGCAGCTCTTGCAGGCTGTAATCACCATCTGGTAATGATTGCAGGAGC
TGGCATTACAACCCAAAGACGACATTGTTGACAGAGCCAAGATGGAGGACACCCTGAAGA
GACGGTTCTTTTACGATCAGGCTTTTGCCATCTATGGAGGTACAGCTTGATTTGAAAGGT
TTTTGCAAATCAATCTACAGTCGTCTTCTCGCTGAGACACGATGTTGTACAGGTGTCAGC
GGTCTGTATGACTTTGGCCCCATGGGCTGTGCCCTGAAGAACAACATCCTGCAGGTCTGG
AGGCAGCACTTCATCCAGGAGGAGCAGATCCTGGAGATCGACTGCACGATGCTGACGCCT
GAGCCTGTCCTCAAGTGAGTGCGTGCTCCCCGGGTCCCGCAGGGGGGTTGTAGTTGTGTG
GGAGGTCGGAAACGAGCGCCTTGTGGTTCCTAGAGTCAGCTTGTTCCTCGGTGCTGAACT
GTGGGGTTTTGTCAACAGGCGCACATTAGTTCTGTGATATTAAGCATGGGAGCTGCCACC
ATAGCAGCCTCCCACAGCCCGGTCGCAGATACACGCACGGGATTCAAGCTGAAGCCCGGC
TGAGCCCATCTGGGAGCAGGAGGGGCTCGCTTTTTCAAAAAAACACCAAACATTGTCTCC
AGGACATCAGGACACGTGGACAAATTTGCTGATTACATGGTGAAAGACGTGAAGAACGGC
GAATGTTTCAGGGCCGACCACCTCCTCAAAGGTGAGGAGTCCCTTTGCCGCTCGCGCCGC
TGCGTCGCCCCAGCGTTTGGGCGGACGTTTCCGTTCCGAGTGGAGACGTCGTTCCGTCAG
ACATGCTCCTGTTCCCCGCAGCTCATCTGCAGAAGCTGATGTCCGACAAGAAATGCACAG
CGGAGAAGAAGGCCGAGATGGAGGAGGTCATCACTCAGGTCAGCCACCGAGGAAAAGCGT
AGAACTGTGGCTGAGGAGGATCCGGTAGTTCCTAAATATGCTTTTCTGTGGGTTCCAGAT
GGACAACTACACCCAGGAGGAACTGTCTGACCTCTTTGTGAAATACACCGTCAAGTCCCC
GACCACGGGGAACGACCTCACTCCACCCATCTCCTTCAATCTGATGTTTCAGACGTCCAT
CGGGCCGGGCGGGAATATGCCAGGGTAGGAGGAAAGAACCCAGTTCCACCTGTCTGTTTG
GCTCTTTTCTCGCCGCCTTGACTCAGTCGGTTCCGTCTGGTCTGCAGCTATCTGAGGCCC
GAAACAGCTCAGGGAATCTTCCTCAACTTCAAGCGCCTGTTAGAGTTCAACCAGGGAAAG
CTGCCCTTCGCCGCCGCTCAGATCGGAAACTCCTTCAGGAACGAGATCTCTCCTCGCTCT
GGACTCATCCGCGTCAGGTAGCGGCGCGGCCCGGCCCGGCCCGGCGCCCCTGCTGCGCGG
TCACCCCTTGCTGAGCCGCTCCCTCCTCACCTCTGTGCAGGGAGTTCACCATGGCAGAGA
TTGAGCACTTTGTGGATCCCAACGATAAGGTGCATCAGAAGTTTGCGAACGTGGCTGACC
TGGAGATCCTGTTGTACTCGTCCAAAGCGCAGACCAGCGGTCAGTCGGCGGCGGTCATGA
GGCTGGGCGACGCCGTGGAGCAGGTGAGGATCCGCTCGGCCGCCGCTGCTGGGAACGCTG
AATGCTCACGCTGGAATCTGGGCCGGTTCAGGGGGTGATCAACAACTCCGTCCTGGGCTA
CTTCATCGGGAGGATCTACCTCTACCTTATCAAAGTGGGCGTGGCCAAAGACAAGCTGCG
TTTCCGGCAGCACATGGACAACGAGATGGCTCACTACGCCTGCGACTGCTGGGACGCCGA
AACCAAAACCTCCTACGTAAGTCCCAGCTCAAGGCCCGCCGGCCCCGGTGTGCTCGTGGA
CCTGACGGGAACCTCCTGTCCGCCCGCAGGGCTGGATCGAGATCGTGGGGTGCGCTGACC
GCTCCTGCTACGACCTGGCGTGTCACGCTCGCGTCACCAAGGTGCCTCTGGTGGCTGAGA
AGCTCCTGAAAGAACCCATATCCTTGATTTGTCTGGTTTCCCAGCTGAGGAGCTTTGACG
ACTCGGCGCGCTGGGCTTTTCCTTCACTCCCCTGCACAAAGTGGTTAACGTTGTCCAGTT
TGAGCCCAACAAAGGAGCCATGGGGAAGGCCTACAAGAAGGATGCCAAGATCGCCATGGA
CTTCCTGTCCATGTGTGACGAGTGTTACATTACAGATCAAGAGAAGCTGCTGAGTGAGAC
TGGGTGAGCGCTGCCGTTGAGAAAGAGGAGCGACCAGGCTGCCGTTTTCAGCAGAACTGA
CCGGGGTGTCTTTGTTTTTAGAGAGTTCACCATCGAGACGGAGGGCAAGACCTTCAAGCT
CACCAAGGACATGGTGTGTGTGAAGCGCTTCCAGAAGACTCTGCACGGTGAGTTTGACCC
CAGAGGGAACAGCCCGGGCCAGAGTGGGAGGGTGATGTAGCTCAGGTTGTCCTTCCCCTC
CTCGTCCCCCACAGTGGAGGAGGTTGTCCCCAACGTCATCGAGCCTTCCTTCGGCATCGG
CCGGATCATGTACACCATCTTTGAGCACACGTTCCACGTCAGAGAAGGCGACGAGCAAAG
AACGGTCCGTCAAACCTTCCAATCGGAAGCGCTCCCGCCCTCTTTGCCAGGTCCTTGACG
CCACTGTTTCATCCCTCCTGCAGTTCTTCAGCTTCCCAGCGACCGTGGCTCCGTACAAGT
GCTCCGTCCTGCCGCTGAGCCCCAACCAGGAATTCGTGCCCTTCGTCCGGAGTCTGTGTG
AGTGCTCGCAGCACCAGGCGTGACACCAGCTGCCGTCTCCCAGAAGCCTCATTCCTTTCA
CGCTCTCCCCGTGCAGCCGAGGAGCTGACCAGAAACGGCGTCTCGCACAAGGTGGACGAC
TCCTCCGGGTCCATCGGCAGGCGCTACGCCAGGACGGATGAGATCGGGGTGGCGTTCGGC
ATCACCATCGACTTCGACACGGTGAACAAGACGCCTCATACGGCCACCCTGAGGGACCGC
GACTCCATGAGGCAGATCCGGGCGGAGGTACGGCGGATGAATCCCTCCTGTACGTCCTCA
CCTAGAACGTGGCGGCTAAAGATCCTGTTTTTCTCCCTCCTCAGGTCAGCGAGCTGCCTG
GGATCGTTCGGGATCTGGCCAACGGAACGCTGAGCTGGGCCGTGGTGGAGAGCAGGTACC
CCATCTTTGAAGGACAGGAGACCGGCAGGAGGGACACGGCAGAGGAGTGAGGCGCGGTGG
GCCGCCGCGCTGCACCGGCATCACCGGGAACGTTGCACACAGCCGTCGCCGTGAGTCGCG
TGTTCGTCCCATCAACCAGGCGGAGGACGCTCACACCAGACTTTTCCATGGGAGGTTTCT
CATCCGTAAGCAGTTTCACCATGTCCAGATGTCTGAACGAAGGACAAAATTAAACCTGTT
GGCACCAGTGTGAGGATGCTTCCGTCATTCCAGCTTCCAGGCTGTTTAGGTTAAGATGAA
TCAAACTACCAGCACTTCCAGGGGACCGCCGTCAGGAACCAGGTTGATTTTGTTGGTTCA
GCTTTTAAAAAAGGGAAATTATGCAGCTTAACCAATGACTCTTCCTCTATTGAGAAAATC
TGCTAGTAAGCATCCTTGTTATTTCTTCAAATAAAACCCAGCCTGAATATTATTTGGTAA
CCGTTTTTTTTAAAGATCAACTAAAAATAAAACAAACTCTTTTTATGTGCAGGTGGGATT
ATCACTACATATAAGCAAAAGGATAAAACATTTAATACTCCAAATTGCTCAAAAGAACAT
TTTATACAGTAATATATTAATTAGAAATGAAGTAAAACATTTTTAGTGATTTTATGGCTG
CAAAAATGCTGTTTCTACTCACCGGATATAGCAGGTCCCGGGTAGGTCCGTGAAAGATCG
GCGCTGGCGCCCCCTGGTGGGCGACGGGAGGAACGTCCGAGCCTGCGGACCGGCCAGGTG
ACCTGTGGTCCAGCGGATGAGAGGTTGCCATGGCGACCCAGCGCATGGAGGACACAGAAG
CGGAAAATTTGATTTTGAATGTGAAAGTAATATGTGCATATTATATAAACACATTAAATG
TATTTTTCCCCACAGATTCTGCCTCTAATTTGAAAATCATTGATTTTCTATCTTCAATAA
TAATCTGTTTTATTTAGAGGTTCCTCTCTGACACTTAAGGTTACTGTAAAAAAAAATAGA
TTTATCCTAGCTGGCGTCCGACCTACATTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1138, 1455..1556, 1676..1778, 1852..1993, 2282..2370, 2481..2557, 2638..2783, 2867..3016, 3100..3262, 3331..3495, 3569..3676, 3757..3902, 3981..4066, 4154..4263, 4343..4436, 4516..4706, 4784..4909
1001..1138, 1455..1556, 1676..1778, 1852..1993, 2282..2370, 2481..2557, 2638..2783, 2867..3016, 3100..3262, 3331..3495, 3569..3676, 3757..3902, 3981..4066, 4154..4263, 4343..4436, 4516..4706, 4784..4909
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved