Tetraodon_nigroviridis Locus rpl21
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl21
Tetraodon_nigroviridis
rpl21
6
SNORA27
2278..2405
4074
CGCCCCACGCACGGGGACTGGCAGCGTCTCCGTGCCAAAGCCTTCCCTCCAGAGCTGGG
TTTCTGCTGACAGGCTGGCCAGTGTTTTAGCCTGGCTAACTGGTGCGTTAGCCACTTAGC
CCAGAATCACTGCTGCAGCAGGTGAGTGCCGTCACAGTTCTCAGCAACACCAGGGCCAAC
CTCGGCCAAATCAGCTGTCAACTGCGATTTGAACTAAATCCCGCATTACAGAGTACGAGG
CGAACCCTAACAGCAAAAGCAGATCATAATAACAGGCTGTGGGTGGTTTCTCGCCTGATC
CGGAAAACTGCTCGGCTAGCTTAGACAACACTGGGTGCTTTTATCTACAATTCTATGGTT
TAATAGCAGCCATCGGCAATCGAATGGTTTCCCTATCACTAAATTACAGTAGCAATGCCT
CAACAGATCTTTGGTAAACTCACCATGGTACAAAAAGAGGTAAATTTGGAGACTGTCATT
AGGATTTCCATCCGGCTAACGCCATCTTCCACCTCACAGCCGCGCGCTGACAAGACTGGG
CTGGCTCCCCTCGTGAGGGCGAACAGGCGATTTTGCTAACGGAAAGTCCGGCTCGGGAAA
AACAAAGTGATCCGTTTCGAAGCTTTCTGTTCTCGTTTTCTTCATTTGGTTTCTAATAAG
TCCTGTTTGGTAAAGGCAGGCTCCTAGAAAACAACGCGGACGATTTCCACGATTATGAGT
AAAGTAACTACGTACGCGATCAAAACATTTAAGAACGTTTCTTCAACTGTGCGCATGCGC
CGTGTATTACTGCAAATCCTGCGACAGATATGAACAATTTGCATTGCAAACACTTTGGAA
TATAAAATTCCAATACAGTTATAGGAGATGTCTGGTATGAAGTAAGTATAATGTGGTGTA
ACTCAGATTTATTTGTCCCTTTTTTTTTAAATTTCTTCGGTGCCAATTTATTTTGATCAG
GCATTATTGCTGTATACCTTAGCTGTGTGTCACAAGGCGGACCTTGGGGCCTGAGGCTCT
CTCTTTTACCTGCACCGGCCATCTTGTATAGACCCGGGGTAAGAACTTCTCCACAATAAA
TTAGATTTTCCATATTTTATCGCCGTATCCGTTTATAGTTTTAGTAAGATACTCCCCAGA
CATTCTTTGTCATACGTGAAAAAGTTGACATCTTCTGGAAAATGGCTTTTTTGTGCCGTA
TTTGTTTGTTCAGCGTGAATGGGGCTAGTGGCGTGGTTCCCCATGTGGGCCTCCGGTCCA
CCCGAAGTAGAAACACTACTGTATTCTTCAGAGAATTGACCCTCCTAATAGTTGTTTTTT
GTGAATTATTCTATTTGATTAAAAATGCAGACAGTCTTTTTCGATCGTGCTTGCGTGCTT
ATATCGTGCTAGCCGATGCTAGCCTACTTCCTGCGGCCGTGTGGAGCTAGCAGCGTGTCG
TTGTGTAGCAGAAGGACCAAAAGCGCCCAGAATTCTTTTGCTAATCAGAATTTTACTCCT
CTTTTCGGACATTGTTGATTCAGGGGTCACGTCAGCATTTTACACATCATAGTGGTGATG
TGCGCCTAAAAATATTGAACATTTTCATCGACCCATCACATGTGTACCTACGCTTATCAC
GAGTCATCTGATTTAGCATGATACAACTGCTAATAATTAATAACTGAATTTAATTATTTT
TTTCTTGATAGTAAACAGGCATCATGACGAACACAAAAGGCAAGAGGAGGGGAACCAGGT
ACATGTTCAGCAGGCCATTCCGCAAACATGGTGAGCACCATCAGGCGCTGTCATTTCACA
GCTTTTACCTCTGACCACAATCTTTTTATACACCCAAGCTTGTGTAGATGAAGACAATGT
GGCTGTTACTTCACAGGCCCCGTTCCCCTGTCAACATACATGCGCATCTACAAGAAGGGT
GACATCGTTGACATCAAGGTACGACCGTGATTTGGTGCCAACTTTCCAAATTAGATGGTG
CGATATTAATCTGCTGTTGTATTTTTGCTTGTCATTTTTAGGGTACCGGTACAGTCCAGA
AAGGAATGCCTCACAAGTGTTACCATGGCAAAACGGGACGAGTGTACAACATAACCCAGC
ATGCTGTTGGCATCATTGTCAACAAGCAGGTCAAGTAAGTGGCATTTCTGGGATTCACTC
TGTAACTTTGACCTTTATTTATAGTTGCGATCAATCTTTTATTTTTAAATAACCGTTTTT
TTCACCCAACACAACGTCCTTTTGCATCACTGGCTCTTAAATGGTCAGTGGGGAATGTGG
CCCCACCTTCACTTTGCCACCAGGGCTGTTGATGTCGTGAGTGGTCATTCGTGTGGGGAA
AAGCATTTCATCCTCGAACACCCCAGTCAAACCCGTTTGTTCTGGGTCTGTCCCGAGGAA
ACAGCAGAGCTGCATGAAAGATCGACATTTTTAGAAAAGAAAACTGCTCCTTGCTCTACA
TTTATTCTGGCAGTTTTTGTTAGTTTAGAAGAGCTTGAGTCAGACTTTTTGGTCAAAGTG
GATATACTAAGAGTGTTTTTCTTAAATGTTGGTTCAACTCCTAATCGTATGTTTCAGGGG
TAAGATCCTGGCCAAGAGGATTAACGTGCGCATTGAGCACGTGAAGCACTCAAAGAGCAG
AGACAGTTTCCTCCAACGTGTCAAAGAAAACGAGGCTAAAAAGTTGGAGGCCAAGCAGAA
GGGCACCTGGGTGGAACTGAAACGTCAGGTATAAAATCTTTAGGAGTTTGAAGTCAAAGA
ATGATTTATGAAAGTAAGCTAGCTTTTAAAAATATTAAGAAATTTTAATATGAAAGGTAC
AGTTGGCTACAGAGAATCTTTGCTGGATGCGGTTTGACTGGTTGATGGTTGTGTTACACA
CTGAATGGAACTTTTTCCTGGCAATCTCTGATCTTGAAGTTCTAAAGTTGATGTTTTTGT
CCCTCCAGCCTGCTCCGCCCCGGGAAGCTCACTTTGTCAGCACCAAGAGGAACGCGCCAC
AGCTGCTGGAGCCCATTCCATACGAGTTCATGGCATAAAGAGCTGGAAAAAATAAACTTT
TGTTCACATGTCGCTTGTCGTCTTCTCTGTGCAAATATTTACCTTGTCGGTTGGTTGCGG
TTATGGCTATTATGGAGCCACATTATGACCTTTGCTGTCAGCCAAATATTCTCCTTTGAT
GTCTCAGAATTAAGATTAGTTTCAGAGGAACACAATTATCCATCTCAAATTAATTTAAAT
TCATGAAACCTGTGACTGGCCGGTTCGCGCATGCGCAAAGGAGTCTAACGCTAACGGCCT
TCTAGCCCTCGCCGGTTCGCGCATGCGCAAAGGAGTCTTACGCAACCGGCCTTCTAGCCC
TTGCCGGTTCGCGCATGCGCAAAGGAGTCTCGCGCATGCGCAAAGGAGTCAAAGGCAACT
TTTTTTTCTTTTTTTATAGGGTGGAATTGGCATTAGGCTTACCATTAGCGTGTGGGTTAG
CATTAGCATCAGGGCTAAGGTTAGCGTCAGGGTTCAATATTTTGGACAGCAAAATCCGTC
AGCCCCAGCTGAAAAGTGTTTCTGCCTCGTGCCTCGGCGTCATGCCCCGTTCGCGAATGC
GCAAAGGAGTCTAACGCTAACCGGCCTTCTAGCCCCTGGCCGGATTCGCGCATGCGCAAA
GGAGTCTTACGCAACCGCGCCTTCTAGCCCTCGCCAGTTCGCGCATGCGCAAAGGAGTCT
CGCGCATGCGCAAAGGAGTCAAAGGCAACTTTTTTTTCTTTTTTTATAGGGTGGAATTGG
CATTAGGCTTACCATTAGCGTGTGGGTTAGCATTAGCATCAGGGCTAAGGTTAGCGTCAG
GGTTCAATATTTTGGACAGCAAAATCCGTCAGCCCCAGCTGAACAGTGTTTCTGCCTCGT
GCCTCGGCGTCATGCCCGGTTCGCGCATGCGCAAAGGAGTCTAACGCTAACCGGCCTTCT
AGCCCTGGCCGGTTCGCGCATGCGCAAAGGAGTCTAGCCTCCAGGCAGAAGTCAGAGCAA
CCAGACCTGAAAGCAGAAACCTGAGGTTGAAACGCCTTGGGAGCAACGGGTGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1203..1265, 1691..1769, 1876..1937, 2021..2133, 2577..2727, 2948..3074
1703..1769, 1876..1937, 2021..2133, 2577..2727, 2948..3037
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved