Tetraodon_nigroviridis Locus rpl7
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl7
Tetraodon_nigroviridis
rpl7
6
SNORD12, SNORD12, SNORD12
2169..2259, 2542..2633, 3188..3280
4865
ATCAGCAGCAGACCCAATAGGACGGAGACTTGCGCGCCTGTCAGGATGAAGCGCCGGGT
CCAGACTCTGCACCCAGAGGTGATCTAATCCGAAAGGTTTTACTGAAGCCTTAACGATTC
CGAAAAAAAAAAGCACAAAGACGCGCTCCACCAAGCCAGCGCCGAGCCGCCAATACTAAT
TAGGTTTTTTAGTCTGTTTAGCGACAAAACTGCGTTATTCATTAGTGGGGGTTTTTATGA
GTGGGTATCACGATTTACGAATTTAAAGACAAGAATTAAATTAAACGTTAAAGTTAAATA
ATGTGACCATACAGGTCATCGGGCCATTCCTCCGGTCAATGTCTGCTCGTTCAAAGTAGG
ACAAAACATTCAGAAATCATTTTAAAGTTAATATTATTTGGTTTCTTTATTTTGATTAGC
GTTTGGCTTGAATGAGCTGCGTGCCTGTGTGCGCGCGCGCGCGACATATCTACATTATTA
TTTGCTTTGCTGTGGCAGCATTTAAAAGTGATACTAAGGATAATCTTTCAGTTCGTTACA
TAAGAAAAGGGTTAGGAATAGAATTAAAATTTTGAAAGAAATCACAGTCAATTACCTTTC
ATTTTAACAAGAGAGTTTGAGCTTGTCTGTTTATTAGGTTTTGGTCAACATCATCAACAA
TTAAGCTATTGAGCAATCAAAAAATGTATAAACATCCAGAGGTCTTTATATTCAGAAAAA
AAAAGATAATAACTCAGCTACTGTTTTGTAAAATGCTTTTGTGGGGTTTGAGACCTACCG
GACACTGATATATTATCATTATTTTATTTTATTTTATTTTAATTATTTTATTTATTATTT
TTGCGATCCGCAAATGAAAAAATGAAGCTTTTCCCCCCTCTGCTGGTTAGATTGATGTTT
AGCAGTTGTTTAGTAACAATTATCTTTTTGGTCAGGCAACTACAAGGACAGACACTAGGG
GTCCGACGTTCTTTATCTCGCACATGCGCAAACGGGAAGTTCTCTTTCTCGGTGGACGCA
ATGGCGGACGCAGAGTGAGTGTTTGCAGTCACGTTGAAATCTAAGTACATCCATCGTAGG
CACTATCAATGTTGTTACTTTTAGCTCATATATCGATTGTCTAGTATGTATACGTTATCA
CCTTACGGCTATTGTCATGGATTCGCTTTAGAATCTTAATCACTAACGTTTACACTTTAC
CTGAGCATTTCTGTAGCTGTCGGCCAACATGGCCGGCTTCTTGACTTTGTGTTTTGTAGC
CACAATCAGCTTGTTTTTAGGATATTCCAACGATAAGAGGTCGTGCTGCAGTGTGCGCTT
ATTAGGGTTTTGTATTGTATGTCTGGCTTAGCTTCAGAGGAAGCACAACGATGTAATGTA
AGTAGAGCCAGAACCAATCGTCAATGTAGCAGTTAGCATCTTGAGGCGGCGAGTTACCAG
CACGGCTAAAAGCCGTGTGTATGTTTAACATGCGTTTCGGCGATTATAAGTAAATCATGG
TGTTTCTGAACCAGAAAAAAGGTTCCGGCGGTCCCTGAGAGCCTCTTAAAAAGGCGAAAG
GCCTTCGCCGCCATGAAGGCCCAACGAATTAAGAAGATGCTGGCCGAGAAAAAGGTAAGA
AAGTATCGGAGGTTAGACGCCTGCCTCCTCTGGGCTCGTTAGCGTCCAGCTGAACGCAGA
GATCTCCTCTTAGATGCCCATCACACGAATAAATAAGAATCCACACAGGCATCGTTTGTT
TTTATTTTAATCTGTACGTTGGAATATTTCTGTTTTAAGGCCCGCAAGGTGAAAAGGAAA
TTGATCTTCAAGAGGGCTGAGAAGTACCACAAGGAGTACCGGCAGATGTACAGGCGTGAG
ATCCGCTTGAGCCGCATCGCTCGCAGAGTGGGAAACTTTTATGTTCCAGCAGAGCCCAAA
CTGGCCTTTGTCATCAGAATCAGAGGGTAAGAACGGTCCCCTGAACACAGACCTTTATCC
AGAATTTACATGGATTGCTGTGACGTTATGTGCAAGTAACACACGTTACCATCGTGCTCA
CAAAGTTGTTACTTTGGCCAGACTGGTCCAACACCAGAACACTGGGAAGCATTTGATTTT
TGATAAGATGGTGATTCTGTCTGGCAAAGACGGGTCATCCGTACTGAAAAGCACTCCATG
TAAATTTGAAGTGTGGTTAATGATGTGCTCTCTTTCCCCGACTTATCGACTATGCTGACA
CACTCTCGTCTTATAAGCCAAATGTTGCTGAAACCACAAAGCTCCTTGGTTAGAAATCTC
CCTGCTGCTGTTTTAGAGTAATGTCTAATAGTGTGGTGTGTTTCTAGTATCAACGGTGTC
AGCCCGAAGGTTCGCAAGGTTCTGCAGCTGCTGCGTCTGCGCCAGATCTTCAACGGAGTG
TTCGTCAAGCTCAACAAGGCCTCCATTAACATGCTCAGGATCGCCGAGCCTTACATTGCT
TGGGGGTAACGCTTCTTTTAAAACTTTCTGATCACATTGCTGAATGTAACGGCAGTCATG
TCCTGGTTAGGTCTCGGTCAGGAATGTGGTTGATGATGTCCAACTTTTTTCCCCATCTTA
TCGACCATGGGGACTCCAAACCAATTTAAAGCCAATTGTGTCTGAAACCACGTTCTGTGA
CACTGAGGCCTCTGCCGCTGGGTTGTGTAGCTCGGCTCAGCAGGCTGTCCCGTGGGTAGG
GTTGGGTAGGAGATGAGTGGCTCTTGCTTTGCAGCATCCCACACGGTGATCCTGGTAAAC
GTGGCCTGAATGGCGCGATGACCTCTGATTCCAGCAGCTAGAATGCAGGGTTGAGCTACC
GATGATGTCAGCGCTCACAAGCTGCTTTTAAAGTTACACTCTTAAGCAATGGAATTCTTC
ACAAGGAGAAGTACCTTTGTCTCCATGTCACTGCTTCCACTTGCTCCTGATGTCTTTGTC
ATTTCATTCCAATACTGGACTTCTGTCTTCTAATGAGCCCTCCTCCTCTTCTGCCCAGCT
ACCCTAACCTGAAGTCCGTGCGTGAGCTCATCTACAAGCGTGGCCACGGCAGGATGAGGA
AGCAGCGCATAGCCCTCACAGACAACGACCTGGTGGAGAAGGCCCTCGGTACGCGTTCCA
TTTGACTCTGTGTGCGCGGCACCAGCGTGCAGCCATCTGACGGAGAGAGCGTGGCTGCTC
ACTTTGTAGCTGTGGTTGATGATGCAAGCTTTTTTCCCCGTCTTATCGACTATGGTGAAA
AAAATCAGAAAACTAAGCCAGTTGAGTCTGAAACCACATGCTCTCCCAACACTAGTGAGG
TTATTATGCTTCTGGCCATCCTTTTGGTCACTATTTGGGACGGGTGTTTCCTCACGGAGG
TAAAACCCAACTCTGACCGTGCTGCTCTTCAGTTACCCAATCGTGTTCGATTTTCAGGCA
AATACGGTATCATCTGCGTCGAGGACCTCATCCACGAGATCTATACTGTTGGAAAGAACT
TCAAGCCTGCCAACAACTTCCTGTGGCCCTTCAAGCTGTCCTCACCCCGCGGTGGCATGA
ACAAGAAGACCACGCACTTTGTGGAAGGGGGAGACGCTGGCAACAGGGAGGACCAGATCA
ACAGGCTGGTCAGGAGGATGAACTGATGGTGAGTGGCTCCAACCCGTGGTTGATGATGCA
CTCTTTCCCCGTCTAAGCGACCATGGCGAAGACCCAGGTCTACTTTAAGCCAAACATGTC
TGAAACCACCTACATGAAACTGATTCCCATTGGTTTAGACTTCAGCAGTTAGCGTTTTTA
CATCTTTTCACAAATTCTTTTTTTTCTCTCTTACAGGTTTTCTAAGGACTCAAATGTACA
ATAAACATTTAAAAATCTGCCTTGGACTTGTCTTGCTATTGTCTTGTTTAGGAGAGAGTG
GCTCTTTGAGTGGTGTGTGTGAACCTGTGGGAGTATTATGGTATGTATGTGAAGCTCTTT
GTTACCATGGTAGGTGTTTTGTGGGTGTTGGCTGAGAACTTTAACTCTTAGAAACGCTGT
AAATGTCACGGTTGTATGCAGTTCGGTGACGCTCGTGCCGAACCGGCGGCTGGACCCTGT
AACCATGGCGACGCATTAACTCGGTTAGCAGGGACCGCGCCGGGCGCTAGCGCTGCGGTT
TTGGACCGCGTTGTCGGAGGCAGCCACGGCTTCCATTTGCTATGAAAGCAGTGTGAGCGC
AGCTGTAGTCGGCCAGCTCCAGGATGCTGACTCCCCCCCGGAAGGCGCCGGGCCCGGCGG
CACAGCTCCCCTCGCCGGAGATGAGCCTCGACCGCGGCCAGCGCGGCCTCGGCGCGCCCG
CATGTCCCACCTCCAGGAACCTCCGGATCGGGGCCGGTGGAGGACGGGAGGCAGCGAGCC
GGGAGCCGGTCGGCAGCCCGGACCCGGAGATCCAGCCCCTCCACAGTGAGTCAGCGTGTG
TCGCACATCTGCTACGGGCTGATCACCAGCCAACTGCGTCAGATTAGGGACCTCAGCTGG
GCCGTTTAGAGCGCCTTAGTGATGTCCCAGTGGGCTATCTCACGCTAAAGTTTGAATCTA
GGAATGACACGTGGGGGATCGGTGTTAAACGCCAGAATGTAGCCCGTTTTTGACGCTTTA
GTGTTTTCCGGTGGTCGTCCAGCTGTCTGTAGTACGCCCGGCTCGCCGGCAGGCGGCGGT
GTTGTCCAGCTGACGCCCCAGGTCCAGGACCGGCGGATCGCCGCTTCTGTCTGCTTCCGG
TGCTCTGCTTGAGTGGGAGTTTGACTGTTTGCAACCTTCTAGCCTCAGGATGGCGGAGCA
CCAGAACTGTTATTCCTCCGCTGCAGAGGAACGTCTACCTGCATAAACGTGACCTTCAGC
ACCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 1514..1613, 1779..1945, 2327..2464, 2998..3107, 3417..3627, 3816..3865
1020..1033, 1514..1613, 1779..1945, 2327..2464, 2998..3107, 3417..3625
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved