Tetraodon_nigroviridis Locus Mono:SCARNA15
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SCARNA15
Tetraodon_nigroviridis
Mono:SCARNA15
5
SCARNA15
1001..1133
2133
CAGCTCCACATATAGGCGTAAGTAGATGGGTCTAGGAAGGACCGAAGTAAAAGTGTTTG
GTCTGAATGTGTACTCAACACACAACATTTGATATTTGAGAAAAATCAGTTAGTAAATTG
AAATGCTGTTTTTAATTATACCAAAGTCAGCATTTCATAAAAGAAAATAAAGGACGTAAT
GACAATGAAAGACCAAGTATATTTACCTCGCCCTGGCCTCTTAAGAGTGTCAAAATTCAA
GGCCTATAGGGTAAGCCCTAAGGGACTGCATAGGCCTACAAAAACTGAAGTACAAGTATT
ATACCTCAGCAAGTTATATTCATATGTACAACATATCAATTCATTGTTTCTTAGAGCTTT
GTCCACACAAAGATTTTTGTGGGACTGGACCAGGCACTGCAATCATTCAACGTGAAAGAA
AAGGTTGAGGGTCCAGGGGGGTCATACCTCAGCCACATCCAGACAGAGACGGGTGCTCGG
GTTTTTCTCAGGGGAAAAAACTCTGGCTACATTGAGCAAGCGTCAAAACGCGAGTCCTTC
GAGCCACTGCATGTCTATATAAGGTATGTACTGTATATATCTATAATATACTGTATATAG
ATATGTATAAACATTTTCTGCTCATACCACATAAATGCCAATAAATTCTCACTAGTGACA
GTAAGTTTAAGTAAGCTAATGTCTGGGTAGCCATTCATCATCAAACACTTGGATCTGTGA
CTGATAGATGTTGGTTGTAAAATTCCTAAATTTGCCTACTTCTACCCAAACCACATGCTT
TTAAAATGTAGAGACAGGTTTAGTGTTTGTATAATAGCAAGATATCTTTGTTTTTGTTAT
TAGCTCGCTGTTAAATCACATTAAATAGGATGTCTGTGTGTTCCAGCCACCCAAATGCAG
TTGGATTGGAGGCAGCAAAGAAGCTCACGGAGAGCCTACTTGAAACTGTAAGTTATTGTC
AAAGAGTTGAATAGTGGTGATAGATATAGCTGAGGTGCTGTCAGGAGGTTTAAGAAGGTG
AGACTACTAAAGGATATAGTCTTCACCGATACCCACCTCCTAAAGTGAAAGCGGTAGTGT
GAACCACCTGATCTCCAGAGATAGGTCCTGAGTGCTCTGCACCTACCTACAATCGAACCG
TTGTTGTAAATGAACAAATGTTGTATTAACAGGTAGTTTCCAGGGTTCTTGAACAGAATT
TGCTTTCATTCGCTCTACAGGTCAGAGCTGAACATGCCCGCATCGTGTCGGTGTACACAG
CCACAGGCTCCACACAGCGTGAGTGTTTGTCAATGCTTTTATTGTACTGTGAACACCCCC
CTCGGGATCTGCAAATGCTGCGATTGTGATCATCAGTAACTACCCATGTGACTTTTGCCG
ACAGTAATTTTTTTCCAGAAAAAATGATCGTATCACCTCTTAAGTTTCTTTCTTGTACCG
TAAAAACCGGACTATAGAGCGCACCTGATTATAAGCCGCACCCACTACATTTTTAGAGGA
AAAACCGATTTTGTACATACACAAGCCGCACCTGTATATAAGCCGCATGTGCCCACATTA
AAACATGTAAACATATTTACAAAGAAAGACGGTACACAGAGAGAGTTTTCAAAGTTTTAA
GAATATACCTTAGTTTTTCTTTCCAAACAGTGCCTGTGACGCGGCAGTAACACAGCAGGA
ATACGGTAGCACAGCACTAACAGGGCTGGTTAAAAAAAACGGTAAAAGTCACTGAAAGCC
AGCTCGACTGCTTTTAACTTGAAAGCTGCGTCATATGCATTTCTTCTTGCATTTTCCATG
ATGAGGGTCTGTTCATGCTAATTTTATTCACGGACAAAGCTCGAAGTTACGTTAAACTTG
CATCTTCCTCGACACATATATTCCACCGGTCTCACTCTTACCTTTTCTGCTCGAGCGCCC
CTGGCGGCCGTTAGAAAAAATGCATACATTAGCCGCATCATTGCATAAGCCGCAGGGTTG
AAAGTTTGGGAAAAAAGTAGCGGCTTATAGTCCGGTTTTTACGGTACTTACTTTTACAGC
ACAGTGCCCTAATAATTTGACACTTGCTGCAGTTTTTCAGGCAAACAGTCAAACATCCTT
TAGGGACTTGACTTATTTGAACAGGGTGATTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved